WO2004100976A1

WO2004100976A1 - Klotho protein, anti-klotho protein antibody and use thereof

Info

Publication number: WO2004100976A1
Application number: PCT/JP2004/006899
Authority: WO
Inventors: Itaru Urakawa; Takashi Shimada; Yuji Yamazaki
Original assignee: Kirin Beer Kabushiki Kaisha
Priority date: 2003-05-15
Filing date: 2004-05-14
Publication date: 2004-11-25
Also published as: JP2006240990A

Abstract

It is intended to provide medicinal compositions usable in treating or preventing diseases in which vitamin D participates, that comprise a klotho protein capable of lowering or elevating blood phosphorus and/or activated vitamin D levels and an anti-klotho protein antibody capable of elevating blood phosphorus and/or activated vitamin D levels. A medicinal composition for lowering or elevating phosphorus concentration in blood and/or activated vitamin D concentration in blood which contains a klotho protein as the active ingredient; and a medicinal composition for elevating phosphorus concentration in blood and/or activated vitamin D concentration in blood which contains an anti-klotho protein antibody as the active ingredient.

Description

Description klo tho protein and anti-klo tho protein antibodies and their uses

Technical field

The present invention relates to a Klotho protein that alters phosphate metabolism, vitamin D metabolism, and FGF23 action, an antibody that recognizes the Klotho protein, a complex of the Klotho protein and an FGF23 polypeptide, and uses of these substances. About.

Background art

Phosphorus in living organisms is present in bone, intracellular and extracellular fluids, and plays an essential role in the source of mechanical strength of bone, energy metabolism in living organisms, and maintenance of cell functions. Because of this importance, the serum phosphorus concentration is maintained at a nearly constant level, suggesting the existence of a control mechanism for maintaining the blood phosphate homeostasis. The balance of phosphorus in the body is regulated by excretion in the kidney and absorption in the intestinal tract, but the kidney is considered to be important as a phosphorus balance organ. Specifically, the regulation of phosphate transporter proteins in the proximal tubule of the kidney affects the regulation of blood phosphorus levels. At present, the involvement of parathyroid hormone, 1a, 25-dihydroxyvitamin D3 and FGF3 as substances affecting the change and regulation of serum phosphate concentration is considered. 1,25-dihydroxyvitamin D3 plays an important role in regulating calcium metabolism rather than phosphorus metabolism.

FGF23 is a substance found to be a potent factor in lowering serum phosphorus and serum 1α, 25-dihydroxyvitamin D (W02 / 14504, and Shimada T, etal: Proc Natl

Acad Sc i USA, 2001 May 22: 98 (11): 6500-p6505) ₀ A substance discovered as a result of searching for a tumor-specific gene highly expressed in tumoral osteomalacia accompanied by a decrease in serum phosphorus It causes a decrease in serum phosphate by reducing phosphate transporters in the renal proximal tubule. Also, 1α, 25-dihydroxyvitamin D3 (hereinafter called active vitamin)

Suppresses the expression of 1-hydroxylase, which is a synthase of D3), and conversely increases the expression of 24 hydroxylase, which is an enzyme that decomposes active vitamin D3, to increase the activity of activated vitamin D3 in blood. Decrease concentration. Thus, FGF23 is serum phosphorous, serum It has been shown to have a role in lowering droxyvitamin D, but the substances and pathways that transmit that signal have not been clarified.

On the other hand, klotho mice with a mutant phenotype similar to that of human aging have been shown to exhibit various phenotypes due to insertion mutations of other genes at the klotho locus. Growth retardation, senile skin atrophy, emphysema, deafness, cardiac dysfunction, Monkeberg-type atherosclerosis, low rotational bone loss, ectopic calcification, infertility, abnormal glycemic control, thymic atrophy, B cells Differentiation disorders and the like (W098 / 29544, Kuro-o M, et al: Nature 1997 Vol 390 p45-51). In addition, it has been shown that these phenotypes can be restored by introducing the full-length klotho gene into klotho mice using a virus vector (W098 / 29544, Kuro-o M, et al: Nature 1997 Vol 390 p45). -51) ₀ Furthermore, the extracellular region of the klotho protein is composed of two regions, KL1 and KL2.By administering a protein in which the KL1 region and immunoglobulin are fused to a klotho mouse, the thymus, spleen, It has been shown to suppress testicular atrophy and ectopic calcification (WO00 / 27885). In addition to the various symptoms of klotho mice listed above, it has been reported that klotho mutant mice have increased serum phosphate levels and increased active vitamin D (YoshidaT, et al- .Endocrinology. 2002 Feb; 143 (2): 683-9.), Phosphorus, vitamins)) The expression of klotho protein during renal insufficiency, which is a condition that causes abnormal homeosis, is normal. It has also been reported that it is reduced as compared to the kidney (Koh H, et al: Biochem Biophys Res Comb. 2001 Feb 2; 280 (4): 1015-20.) 1α in ₀ klotho mutant mice It has been clarified that increased expression of hydroxylase is caused, and it is considered that abnormalities of vitamin D metabolism due to abnormal klotho gene are considered.However, the function of klotho protein itself may not be elucidated. Molecular mechanisms related to phosphate metabolism and vitamin D metabolism in abnormalities Parkinsonism is not clear.

Patent Document 1

W002 / 14504

Patent Document 2

W098 / 29544

Patent Document 3

WO00 / 27885 Non-patent document 1

Simada T, et al: Proc Natl Acad Sci USA, 2001 May 22; 98 (11): 6500-ρ65Ό5

Non-patent document 2

Kuro-o · Μ, et al: Nature 1997 Vol 390 p45-51

Non-patent document 3

Endocrinology. 2002 Feb; 143 (2): 683-9

Non-patent document 4

Koh H, et al: Biochem Biophys Res Com Marauder. 2001 Feb 2; 280 (4): 1015-20

Disclosure of the invention

The present invention relates to a klotho protein that decreases or increases blood phosphorus and Z or blood active vitamin D, an anti-klotho protein antibody that increases blood phosphorus and Z or blood active vitamin D, and the action of FGF23. For the purpose of providing a pharmaceutical composition containing a klotho protein or an anti-klotho protein antibody that can be regulated, phosphorus, vitamins) -related neoplastic osteomalacia, ADHR, XLH, renal osteodystrophy, dialysis bone Disease, osteoporosis, hypophosphatemia, rickets, osteomalacia, renal tubular dysfunction, osteopenia, hypocalcemia, hyperphosphatemia, hyper1,25D blood disease, hyperparathyroidism, abnormal Treatment or prevention of diseases such as calcified calcification, pruritus, bone sclerosis, Paget's disease, hypercalcemia, hypoparathyroidism, bone pain, muscle weakness, skeletal deformity, growth disorders and hypo1,25Demia Pharmaceutical composition for And an object thereof is to provide a.

The present invention has been made in view of such circumstances, and an object thereof is to provide a substance capable of controlling blood phosphorus concentration, blood active vitamin D concentration, and FGF23 action, and a use thereof. .

The present inventors found that FGF23 transduced signals into cells (enhanced ERK phosphorylation and increased egrl expression) in the presence of klotho protein, regardless of the full-length klotho protein or solubilized klotho protein, in the kidney of animals. Was found to be caused as well. In addition, it was revealed that FGF23 binds to klotho protein. In addition, the interaction between FGF23 and klotho protein regulates the metabolism of phosphorus and vitamin D. I found it important for the verse. In addition, administration of an antibody that recognizes klotho protein to the mouse successfully increased the concentration of phosphorus and active vitamin D in the blood, and transplanted solubilized klotho protein-expressing cells into nude mice. It also succeeded in lowering blood phosphorus levels and active vitamin D levels. Furthermore, by administering purified solubilized klotho protein to mice, we succeeded in increasing blood phosphorus concentration and active vitamin concentration. Furthermore, it was found that klotho protein or anti-klotho protein antibody could regulate the action of FGF23. From these results, the present invention has been completed, and the present invention can be used as a drug capable of treating related diseases by controlling blood phosphorus and blood vitamin D, or diagnoses of related diseases. I think it could be possible. Therefore, the present invention is as follows.

[1] a pharmaceutical composition for lowering blood phosphorus concentration and blood or active vitamin D concentration, comprising a klotho protein as an active ingredient;

[2] A pharmaceutical composition for increasing blood phosphorus concentration and blood or active vitamin D concentration, comprising a klotho protein as an active ingredient,

[3] a pharmaceutical composition for enhancing the action of FGF23, comprising a klotho protein as an active ingredient;

[4] a pharmaceutical composition for inhibiting the action of FGF23, comprising a klotho protein as an active ingredient;

[5] The pharmaceutical composition according to any one of [1] to [4], wherein the klotho protein is a solubilized klotho protein.

[6] A pharmaceutical composition for increasing blood phosphorus concentration and blood or active piminin D concentration, which comprises an anti-klotho protein antibody as an active ingredient,

[7] a pharmaceutical composition for inhibiting the action of FGF23, which comprises an anti-klotho protein antibody as an active ingredient;

[8] Neoplastic osteomalacia, ADHR, XLH, renal osteodystrophy, dialysis osteopathy, osteoporosis, hypophosphatemia, rickets, osteomalacia, tubular dysfunction, osteopenia, low calcium , Hyperphosphatemia, hyper1,25D, hyperparathyroidism, ectopic calcification, pruritus, bone sclerosis, Paget's disease, hypercalcemia, hypoparathyroidism, bone pain, Phosphorus and Z selected from the group consisting of muscle weakness, skeletal deformity, growth disorders and hypo1,25D Is a pharmaceutical composition according to any one of [1] to [7], which is used for treating and / or preventing a disease associated with vitamin D, and

[9]. A method for screening a substance that alters the blood phosphorus level and the active vitamin D level by contacting FGF23 with the klotho protein, and intracellularly interacting with the FGF23 and the klotho protein. Screening method by detecting signal.

Hereinafter, the present invention will be described in detail.

The present invention relates to klotho protein, an antibody that recognizes klotho protein, an antibody that recognizes klotho protein, a complex of FGF23 and klotho protein, and a use of those substances that alters the concentration of phosphorous in blood, active vitamin]) concentration, FGF23 action It is.

By using the present invention, a pharmaceutical composition comprising at least one of a klotho protein, an antibody recognizing the klotho protein, and a complex of FGF23 and the klotho protein can be used to convert a pharmaceutical composition containing phosphorus and vitamin D into, for example, a tumorous condition. Osteomalacia, ADH, XLH, renal osteodystrophy, dialysis osteopathy, osteoporosis, hypophosphatemia, rickets, osteomalacia, tubular dysfunction, osteopenia, hypocalcemia, hyperphosphatemia Disease, hyper1, 25D, hyperparathyroidism, ectopic calcification, pruritus, osteosclerosis, Pajet's disease, hypercalcemia, hypoparathyroidism, bone pain, muscle weakness, skeletal deformity, It can be used to treat or prevent diseases such as growth disorders and hypo1,25Demia. Solubilized klotho

The solubilized klotho cDNA can be prepared by a known method based on the sequence of human-derived klotho cDNA described in SEQ ID NO: 1 (Genebank accession No. AB005142). For example, it can be prepared by preparing a cDNA library from cells or organs expressing the klotho protein and performing hybridization using a part of the klotho cDNA sequence (SEQ ID NO: 1) as a probe. In addition, RNA was prepared from cells and organs expressing the klotho protein, cDNA was prepared using reverse transcriptase, and oligo DNA was synthesized based on the klotho cDNA sequence (SEQ ID NO: 1). It is also possible to amplify and prepare klotho cDNA by performing a PCR reaction using it as a primer.

The nucleotide sequence of the klotho cDNA obtained as described above is determined. Determination of nucleotide sequence The determination can be performed by a known method such as the Maxam-Gilbert chemical modification method or the dideoxynucleotide chain termination method using M13 phage. Usually, an automatic base sequencer (for example, 373A DNA Sequencer manufactured by PERKIN-ELMER) is used. , Etc.).

SEQ ID NO: 1 shows the nucleotide sequence of human kloto cDNA, SEQ ID NO: 2 shows the amino acid sequence of human full-length klotlio protein, and SEQ ID NO: 3 shows the amino acid sequence of solubilized human klotho protein. Active and Z or low activity bimin

As long as it has D-disease-inducing activity, hyperphosphatemia-inducing activity and no- or highly-active biminin D-disease-inducing activity, or an effect of regulating (enhancing or inhibiting) the action of FGF23, Mutations such as deletion, substitution, and addition may occur in one or several amino acids. The homology at the amino acid sequence level between the human Klotho protein and the mouse Klotho protein is 85% (SEQ ID NO: 2 is the amino acid sequence of the human klotho protein, and SEQ ID NO: 23 is the amino acid sequence of the mouse klotho protein). It is predicted that mouse klotho protein has the same function as human klotho protein. Therefore, in the present invention, klotho protein includes not only klotho protein derived from human but also klotho protein of mouse klotho protein derived from mouse / human klotho protein having amino acid homology of 80% or more, preferably 85% or more. included. A protein comprising an amino acid sequence of klotho protein derived from any of these animal species other than humans, wherein the protein has a hypophosphatemic-inducing activity and a Z- or low-activity bieminin D-inducing activity, and hyperphosphatemia. Inducing activity and

Z or highly active vitamin!) As long as it has an activity to induce bloodemia or regulate the action of FGF23, one or several amino acids in the amino acid sequence have mutations such as deletion, substitution, or addition. May be. Whether the protein has hypophosphatemia-inducing activity and / or low-activity biminmin D-induction activity or hyperphosphatemia-inducing activity and Z or hyperactive vitamin D-induction activity Examples described later

Cells expressed in cells expressing the protein were transplanted into mice, or the protein was administered to mice, etc., according to the method described in 13 or Example 29, and the serum phosphorus concentration or

The 1,25-dihydroxyvitamin D concentration may be measured. Whether or not the protein has an effect of regulating the action of FGF23 can be determined by administering a solubilized klotho protein and purified FGF23 to mammalian cells, for example, by referring to the method described in Example 28 below. What is necessary is just to determine whether the stimulating effect of FGF23 on cells is affected. Further, FGF23 is involved in the phosphorylation of ERK, and it can also be measured whether or not the effect of FGF23 is regulated by using as an index that the ERK phosphorylation of FGF23 is enhanced or suppressed.

For example, one or several, preferably 1 to 10, more preferably 1 to 5 amino acids may be deleted from the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 23. One or several amino acids, preferably 1 to 10, more preferably 1 to 5 amino acids may be added to the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 23; Even if one or several amino acids, preferably 1 to 10, and more preferably 1 to 5 amino acids of the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 23 are substituted with other amino acids, Good.

As a substitution method, conservative substitution within a family that retains the properties of amino acids to some extent may be performed. Families, which are generally classified based on the characteristics of the side chains of amino acid side chains, include the following.

(1) Acidic amino acid family 1: aspartic acid, glutamic acid

(2) Basic amino acid family: lysine, arginine, histidine

(3) Non-polar amino acid family: alanine, norin, leucine, isoleucine, proline, fenylalanine, methionine, triptophan

(4) Uncharged polar amino acid family: Glycine, Asparagine, Glutamine, Cystine, Serine, Threonine, Tyrosine

(5) Aliphatic hydroxyamino acid family: serine, threonine

(6) Amide-containing amino acid family: asparagine, glutamine

(7) Aliphatic amino acids: alanine, norin, leucine, isoleucine

(8) Aromatic amino acid family: phenylalanine, tributofan, tyrosine

(9) Hydrophobic amino acid family: leucine, isoleucine, norin '

(10) Small amino acid family: alanine, serine, threonine, methionine, glycine

In the present invention, in order to introduce a mutation into at least a part of the amino acid sequence of the solubilized klotho protein of the present invention, a mutation is required in the nucleotide sequence of DNA encoding the amino acid. The method of introduction is adopted.

Mutation can be introduced into DNA by a known method such as the Kimkel method or the Gapped duplex method, or a method analogous thereto. For example, a mutation is introduced based on a site-directed mutagenesis method using a mutant oligonucleotide as a primer. Mutagenesis kits (for example, Mutan-K (TAKARA), Mutan-G (TAKARA) ), TAKARA's LA PCR in vitro Mutagenesis series kit, etc.).

Further, it hybridizes with the probe prepared from the DNA of the present invention (SEQ ID NO: 1) under stringent conditions, and has a hypophosphatemia-inducing activity and / or a low-activity-type vitamin Demia-inducing activity. The DNA of the present invention also includes a DNA encoding a protein having a hyperphosphatemia-inducing activity and an activity of inducing Z or highly active vitamin D bloodemia, or an effect of regulating the action of FGF23. Such a DNA sequence has a homology of 70% or more, preferably 80% or more, more preferably 90% or more, and particularly preferably 95% or more with the sequence of the DNA shown in SEQ ID NO: 1. As described above, these DM sequences also include klotho proteins derived from non-human animal species such as mouse klotho protein. The probe refers to a probe having a complementary sequence to the full length of the sequence shown in SEQ ID NO: 1 or a probe having a complementary sequence to a continuous sequence (partial sequence) having a length of 17 bases or more.

Here, stringent conditions refer to those having a sodium concentration of 750 mM or more, preferably 900 mM or more, and a temperature of 40 ° C. or more, preferably 42. Specifically, it refers to the conditions of 6XSSC, 5XDenhardt, 0.5% SDS, 50¾ Formamide, 42. 6XSSC means 900 mM NaCl and 90 mM sodium citrate. Denhardt's solution (Denhardt) is a solution containing BSA (polyserum albumin), polyvinylpyrrolidone and Ficoll400. 50xDenhardt is composed of 1% BSA, 1% polyvinylpyrrolidone and l% Ficoll400. Means one tenth of the concentration).

In addition, the protein encoded by the DNA of the present invention may have hypophosphatemia-inducing activity and Z or low-activity vitamin D-blood-inducing activity, hyperphosphatemia-inducing activity and / or a highly active vitamin]) Whether the protein has the disease-inducing activity or the effect of regulating the action of FGF23 is analyzed by referring to the methods described in Examples 13 and 29 described below. The expressed cells can be transplanted into mice, or the protein can be administered to mice, etc., and the serum phosphorus concentration or 1,25-dihydroxyvitamin D concentration measured, and the protein regulates the action of FGF23. It is determined whether or not FGF23 is administered to mammalian cells by solubilizing klotho protein and purified FGF23, for example, by referring to the method described in Example 28 below. It is sufficient to determine whether the stimulus effect is affected.

Once the nucleotide sequence of the DNA of the present invention is determined, the DNA of the present invention can be obtained by chemical synthesis or by PCR using a primer synthesized from the determined nucleotide sequence. Preparation of recombinant vector and transformant containing DNA of the present invention

(1) Preparation of recombinant vector.

The recombinant vector of the present invention can be obtained by ligating (inserting) the DNA of the present invention into an appropriate vector. The vector into which the DNA of the present invention is inserted is not particularly limited as long as it can be replicated in a host, and examples thereof include plasmid DNA and phage DNA.

Plasmid DNAs include Escherichia coli-derived plasmids (eg, pBR322, pBR325, PUC118, pUC119, etc.), Bacillus subtilis-derived plasmids (eg, ρϋΒΙ, pTP5, etc.), and yeast-derived plasmids (eg, YEpl3, YEp24, YCp50) Phage DNA includes λ phage. Also, animal viruses such as retrovirus, adenovirus or vaccinia virus, or insect virus vectors such as baculovirus can be used. Furthermore, a fusion plasmid in which GST, His-tag, etc. are linked can also be used.

In order to insert the DNA of the present invention into a vector, first, purified DM is cut with an appropriate restriction enzyme, inserted into an appropriate vector DNA restriction enzyme site or a multicloning site, and ligated to the vector. Is adopted.

The DNA of the present invention needs to be incorporated into a vector so that the function of the DNA is exhibited. Therefore, the vector of the present invention contains, in addition to the promoter and the DNA of the present invention, cis elements such as enhancers, splicing signals, poly-A addition signals, selection markers, and ribosome binding sequences (SD sequences), if desired. Can be linked. Examples of the selection marker include a dihydrofolate reductase gene, an ampicillin resistance gene, a neomycin resistance gene, and the like.

(2) Preparation of transformant

The transformant of the present invention can be obtained by introducing the recombinant vector of the present invention into a host so that the target gene can be expressed. Here, the host is not particularly limited as long as it can express the DNA of the present invention. For example, bacteria belonging to the genus Escherichia such as Escherichia coli, Bacillus such as Bacillus subtilis iBacillus subtil is), bacteria belonging to the genus Pseudomonas such as Pseudomonas [, or Saccharomyces cerevisiae [ Saccharomyces cerevisiae), mother of the like is ¹¹ Nosakkaromisesu-Nbe (Schizosaccharomyces pombe) is respected ^ be. Animal cells such as COS cells, CH0 cells, HEK293 cells, and insect cells such as Sf9 and Si21 can also be used. When a bacterium such as Escherichia coli is used as a host, the recombinant vector of the present invention is capable of autonomous replication in the bacterium, and comprises a promoter, a ribosome binding sequence, the DNA of the present invention, and a transcription termination sequence. Is preferred. In addition, a gene that controls a promoter may be included. Examples of Escherichia coli include Escherichia coli JM109 and HB101, and examples of Bacillus subtilis include Bacillus zubuchi (TABacillus ^ Μ / ^). Any promoter can be used as long as it can be expressed in a host such as E. coli. For example, a T7 promoter derived from Escherichia coli phage, such as a trp promoter, a lac promoter, a PL promoter, and a PR promoter, may be used. An artificially designed and modified promoter such as the tac promoter may be used. The method for introducing the recombinant vector into bacteria is not particularly limited as long as it is a method for introducing DNA into bacteria. For example, a method using calcium ions, an election port poration method and the like can be mentioned.

When yeast is used as the host, for example, Saccharomyces cerevisiae (Schizosaccharomyces lord b) Pichia pastoris (Sodium A / a /?) Is used. The promoter is not particularly limited as long as it can be expressed in yeast. For example, gal promoter, gal l promoter, heat shock protein promoter, MF o! 1 promoter One night, PH05 promoter, PGK promoter, GAP promoter, ADH promoter, A0X1 promoter and the like. The method for introducing the recombinant vector into yeast is not particularly limited as long as it is a method for introducing DNA into yeast, and examples thereof include an elect-portation method, a spout-type plast method, and a lithium acetate method.

When animal cells are used as the host, monkey cells COS-7, Vero, Chinese ham cells—ovary cells (CH0 cells), mouse L cells, rat GH3 cells, or human FL, HEK293, HeLa, or Jurkat cells are used. . As the promoter, an SRa promoter, SV40 promoter, LTR promoter, iS-actin promoter or the like may be used, or an early gene promoter of human cytomegalovirus may be used. Methods for introducing the recombinant vector into animal cells include, for example, the electrophoresis method, the calcium phosphate method, and the lipofection method.

When insect cells are used as a host, Si9 cells, Si21 cells and the like are used. As a method for introducing a recombinant vector into an insect cell, for example, a calcium phosphate method, a riboaction method, an electoral poration method, or the like is used. Klotho of the present invention

The klotho protein of the present invention refers to SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 2.

A protein having the amino acid sequence shown in 3, or

A klotho protein derived from other animal species other than human and mouse having 80% or more, preferably 85% or more amino acid sequence homology, and the above-mentioned hypophosphatemia-inducing activity and no or low activity It has an activity of inducing type V vitamin D, an activity of inducing hyperphosphatemia and an activity of inducing or hyperactive biminin D, or an effect of regulating (enhancing or inhibiting) the action of FGF23. Further, the klotho protein in the present invention includes a hypophosphatemic-inducing activity and / or a low-activity vitmin, a D-hyperphosphate-inducing activity, a hyperphosphatemia-inducing activity, and a Z- or highly-active vymin.

As long as it has D-disease-inducing activity or an effect of regulating the action of FGF23, it has an amino acid sequence in which one or several amino acids in the above-mentioned amino acid sequence are substituted, deleted and / or modified Proteins are also included. Furthermore, such substitutions, deletions, modifications and additions may be in the case of a plurality of combinations.

Hypophosphatemia-inducing activity and / or low-activity type vitamin D-induction of the present invention The klotho protein having activity, hyperphosphatemia-inducing activity and no- or highly-active biminmin D-hememia-inducing activity, or an effect of regulating the action of FGF23, has the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 1 A sequence containing the nucleotide numbers 1 to 293 4 of the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence encoding the klotho protein of another animal species or nucleotide numbers 1 to 293 4 of the nucleotide sequence of human klotho DNA The transformant can be produced by introducing a sequence containing the sequence corresponding to No. 1 into a suitable host cell in an expressible form, preparing a transformed cell, and expressing the introduced DNA in the transformed cell. In addition, the protein thus produced may be subject to modification of the polypeptide chain such as cleavage or glycosylation by the protein modification mechanism of the host.

The klotho protein of the present invention can be obtained by culturing the transformant and collecting from the culture. The term “culture” means not only the culture supernatant but also cultured cells or cultured cells, or cells or disrupted cells. The method for culturing the transformant of the present invention is performed according to a usual method used for culturing a host.

The culture medium for culturing transformants obtained using microorganisms such as Escherichia coli and yeast as a host contains carbon sources, nitrogen sources, inorganic salts, etc. that can be used by the microorganisms, and efficiently cultivates the transformants. As long as the medium can be used, either a natural medium or a synthetic medium may be used. Examples of the carbon source include carbohydrates such as glucose, fructose, sucrose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Nitrogen sources include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium phosphate, and other inorganic or organic acid ammonium salts or other nitrogen-containing compounds, as well as peptone, meat extract, corn steep liquor, etc. Is mentioned. Examples of the inorganic substance include potassium phosphate monobasic, potassium phosphate phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate, and the like.

The cultivation is usually carried out at 37 under aerobic conditions such as shaking culture or aeration / agitation culture at 4 to 48 hours. During the cultivation period, the pH is maintained at 6.0 to 8.0. The pH is adjusted using an inorganic or organic acid, an alkaline solution, or the like. During the culture, an antibiotic such as ampicillin-tetracycline may be added to the medium as needed.

Transformation with an expression vector using an inducible promoter When culturing a microorganism, an inducer may be added to the medium as needed. For example, when culturing a microorganism transformed with an expression vector having a を 7 promoter which is inducible with isopropyl- / 3-D-thiogalactopyranoside (IPTG),

IPTG or the like can be added to the medium. When culturing a microorganism transformed with an expression vector using a trp protein that can be induced with indoleacrylic acid (IAA), IAA or the like can be added to the medium.

Examples of a medium for culturing a transformant obtained using animal cells as a host include commonly used RPMH640 medium, DMEM medium, and a medium obtained by adding fetal calf serum or the like to such a medium. Culturing is usually, 5% C0 ₂ presence is performed 1-10 days at 37 ° C. During culture, antibiotics such as kanamycin and benicillin may be added to the medium as needed. When the klotho protein of the present invention is produced intracellularly or intracellularly after culturing, the objective polyclones are disrupted by sonication, repeated freeze-thawing, homogenizer treatment and the like to disrupt the cells or cells. Collect the peptide. When the klotho protein of the present invention is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or the like. Thereafter, by using a general biochemical method used for isolation and purification of the protein, for example, ammonium sulfate precipitation, gel chromatography, ion exchange chromatography, affinity mouth chromatography, etc., alone or in an appropriate combination, The polypeptide of the present invention can be isolated and purified from the culture.

The in vivo activity of the klotho protein of the present invention is determined by the experiments of subcutaneously transplanting the above-mentioned recombinant cells expressing the klotho protein of the present invention into nude mice and the experiment of administering solubilized klotho protein intravenously to mice. Was evaluated.

The cells implanted in this study grow subcutaneously in nude mice to form tumors. Accordingly, the polypeptide of the present invention, which is produced and secreted by cells, is released into the body fluid of mice. In this experiment, FIG. 8 (Example 1)

As shown in 3), mice transplanted with cells expressing the klotho protein of the present invention were transplanted with control CH0 cells not transfected with the DNA of the present invention to form individuals or tumors. They had apparent hypophosphatemia and hypoactive vitamin Demia compared to non-treated individuals. This indicates that the klotho protein of the present invention has hypophosphatemia-inducing activity and low-active vitamin Demia-inducing activity. Became clear.

In addition, when solubilized klotho protein was administered to mice, an increase in blood active vitamin D concentration was observed, and the klotho protein of the present invention showed hyperphosphatemia-inducing activity and highly active vitamin D-inducing activity. It became clear that it had. It has also been clarified that parathyroid hormone reverses the effect on bone between continuous administration and intermittent administration, suggesting that the klotho protein of the present invention also shows different activities depending on the administration method.

In the present invention, the above proteins can be modified. For example, appropriately select and use polyethylene glycol, dextran, poly (N-vier-pyrrolidone), polypropylene glycol homopolymer, polypropylene oxide / ethylene oxide copolymer, polyoxyethylated polyol, polypinyl alcohol, etc. I do. As the modification method, any known method can be adopted, and is disclosed in detail, for example, in Japanese Patent Publication No. H10-510980. Anti-klotho protein antibody

The anti-klotho protein antibody in the present invention is an antibody or a part of an antibody reactive with the klotho protein or a part thereof as defined above. The antibody of the present invention includes a heavy chain and a Z having an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of each of the heavy chain and Z or the light chain constituting the antibody. Alternatively, a monoclonal antibody which consists of a light chain and can bind to the k101ho protein is also included. In the amino acid sequence of the anti-klotho protein antibody of the present invention, the partial modification of amino acids (deletion, substitution, insertion, addition) as described above partially modifies the nucleotide sequence encoding the amino acid sequence. Can be introduced. These modification techniques are well known to those skilled in the art, and a commercially available mutagenesis kit or the like can be used.

(1) Antibodies that specifically recognize and bind to the partial structure of klotho protein ''

To obtain antibodies that are useful for detecting klotho proteins and regulating biological activities, obtain antibodies that recognize structural characteristics of klotho proteins, antibodies with high affinity, and antibodies that can neutralize biological activities. Is valid. Since the structure and antigenicity of the Klotho protein are unknown, multiple An antibody against each peptide was obtained by synthesizing the tide. Using these, the klotho protein secreted by the expressing cells was detected by Western blotting, and it was revealed that the mature klotho protein was expressed in the expressing cells and in the culture supernatant. In addition, the obtained antibodies showed various binding specificities for the mature klotho protein and the peptide generated by its cleavage.

(2) Antibody production

The antibody of the present invention can be produced, for example, by the following production method. That is, for example, the klotho protein as defined above, or a part thereof, or a conjugate with an appropriate substance (for example, bovine serum albumin or the like) for enhancing the antigenicity of the antigen is optionally immunized. Immunize non-human mammals, including human antibody-producing transgenic mice, together with activators (such as Freimd's Adjuvant). Alternatively, immunization can be performed by administering an expression vector incorporating DNA encoding the klotho protein. Polyclonal antibodies can be obtained from serum obtained from immunized animals. Monoclonal antibodies were prepared by preparing hybridomas from antibody-producing cells obtained from immunized animals and myeloma cells (myeloma cells) that lack the ability to produce autoantibodies, cloned the hybridomas, and used them as antigens for immunization. It is produced by selecting a clone that produces a monoclonal antibody showing specific affinity for it.

More specifically, it can be produced as follows. Hybridomas secreting monoclonal antibodies were prepared according to the method of Kohler and Milstein et al.

(Nature, 1975 Vol. 256: 495-497) and the method according to it. That is, antibody producing cells contained in the spleen, lymph node, bone marrow, tonsil, etc., preferably in the lymph node or spleen, obtained from the animal immunized as described above, and preferably in mice, rats, guinea pigs, hamsters, and egrets. Alternatively, it is prepared by cell fusion with a myeloma cell derived from a mammal such as a human or the like which is not capable of producing autoantibodies. Screening of hybridoma clones producing monoclonal antibodies is performed by culturing hybridomas, for example, in a microplate, and determining the reactivity of the culture supernatant in the wells in which proliferation has been observed with the immunogen, for example. The measurement can be performed by enzyme immunoassay such as ELISA.

Production of monoclonal antibodies from hybridomas It can be performed by culturing in a toro and isolating from the culture supernatant. Alternatively, it can be isolated from ascites by culturing in an ascitic fluid in ascites of mice, rats, guinea pigs, hamsters, or egrets.

In addition, a gene encoding a human monoclonal antibody is cloned from an antibody-producing cell such as a hybridoma and inserted into an appropriate vector, which is then used as a host (eg, a mammalian cell line, Escherichia coli, yeast cells, insect cells, plant cells, etc.). Cells, etc.) to produce recombinant antibodies produced using genetic recombination technology.

(PJ Delves., ANTIBODY PRODUCTION ESSENTIAL TECHNIQUES., 1997 WILEY, P. Shepherd and C. Dean., Monoclonal Ant ibodies., 2000 OXFORD UNIVERSITY PRESS, JW Goding., Monoclonal Ant ibod ies: princ iples and pract ice., 1993 ACADEMI C PRESS) ₀ Further, using a transgenic animal production technology, a transgenic transgenic goat, goat, sheep, or horse in which the gene of the antibody of interest has been incorporated into the endogenous gene is produced. It is also possible to obtain a large amount of a monoclonal antibody derived from the antibody gene from the milk of the transgenic animal. When hybridomas are cultured in vitro, the hybridomas are grown, maintained, and preserved in accordance with various conditions such as the characteristics of the cell type to be cultured, the purpose of the test and research, and the culture method. It can be carried out using any known nutrient medium such as that used to produce monoclonal antibodies or any nutrient medium derived and prepared from a known basal medium.

As shown in Example 10, a polyclonal antibody of the present invention was prepared by binding a chemically synthesized partial peptide of kloto protein to cysiglobulin, which is a carrier protein, to immunize egrets. Antibodies to each of the peptides induced by immunization were purified by an affinity column on which the peptide used for immunization was immobilized. The characteristics of the antibody thus obtained were examined by Western blotting, and the reactivity with the klotho protein was clarified. Further, as shown in Examples 22 and 23, a specific antibody against the klotho protein was prepared using the purified solubilized klotho protein as an antigen.

FGF23 action

FGF23 has an important role in the metabolism of phosphorus 1,25D in vivo. For example, It has been suggested that missense mutations in the FGF-23 gene are involved in the induction of hypophosphatemic disease in ADHR patients (The ADHR Consortium. Autosomal dominant hypophosphatemic rickets is associated with mutations in FGF23. Nature Genet. 26 : 345-348, 2000). In addition, we have identified FGF-23 as a tumor-inducing disease-causing factor in neoplastic osteomalacia (Shimada, T., Mizutani, S., Muto, Τ., Yoneya, T., Hino, R. Takeda, S, Takeuchi, Y., Fujita, T., Fukumoto, S and Yamashita, T. Cloning and chatacterization of FGF23 as a causative factor of tumor-induced osteomalacia. Proc Natl. Acad. Sci. 98: 6500-6505, 2001). These studies suggested that FGF-23 may be involved in hypophosphatemic diseases and diseases associated with cull and osteomalacia.

XLH, the most prevalent of the inherited hypophosphatemia, is said to be present in about 1 in 20,000 people. Although the gene responsible for XLH has been identified as PHEX, this gene consists of a single exon, and its gene region spans 220 kb, so that mutation analysis that causes a genetic disease is currently impossible for diagnostic purposes. is there. Sudden cases and adult-onset cases have also been suggested. So far, the association between PHEX and FGF-23 has not been clarified. Hyp mice, which are spontaneously mutated mice, are known as model animals for XLH. In this mouse, the deletion of the 3 'region of the PHEX gene has been confirmed, and it is known that the mouse exhibits hypophosphatemia, cull disease and osteomalacia. We measured the blood concentration of FGF-23 in Hyp mice using the blood FGF23 measurement system, and found that the concentration of FGF-23 was extremely high. We found that osteomalacia may be caused by elevated levels of FGF23 (Increased circulatory level of biologically active full-length FGF-23 in patients with hypophosphatemic rickets / osteomalacia.J Clin Endocrinol Me tab. 2002 Nov; 87 ( ll): 4957-60).

As described above, FGF-23 has an activity to reduce blood phosphorus concentration and 1.25D concentration. Experiments on neutralization of FGF-23 activity revealed that FGF-23 plays an important role in maintaining the metabolic balance of phosphorus and 1,25D even in normal health

(W003 / 057733) _o Therefore, FGF-23 is involved in phosphorus metabolism and vitamin D metabolism, and is associated with diseases such as neoplastic osteomalacia, ADHR, XLH, renal osteodystrophy, Dialysis osteopathy, osteoporosis, hypophosphatemia, rickets, osteomalacia, renal tubular dysfunction, osteopenia, hypocalcemia, hyperphosphatemia, hyper1,25D blood disease, hyperparathyroidism Disease, ectopic calcification, pruritus, bone sclerosis, Paget's disease, hypercalcemia, hypoparathyroidism, bone pain, muscle weakness, skeletal deformity, growth disorders, and hypo1,25D Diseases may be treated by controlling the action of FGF-23. In addition, as shown in Example 28, the addition of a complex of FGF23 and solubilized klotho protein stimulates osteoblast-derived cells, which may affect cell morphology and intracellular signal transduction. It became clear. These results suggest that FGF23 and klotho protein directly act on cells related to bone metabolism such as osteoblasts, and that the effects of FGF23 on bone metabolism-related diseases can be measured using klotho protein-anti-klotho antibody. It is thought that treatment can be made possible by controlling the temperature.

Complex of FGF23 and klotho protein

The complex of FGF23 and klotho protein in the present invention can be produced by mixing an FGF23 molecule (described in W002 / 14504) with a klotho protein as defined above. The FGF23 molecule in the present invention can be produced by appropriately using a known method known in the technical field such as a chemical synthesis method, a cell culture method, or a modification method thereof, in addition to a genetic recombination technique. For example, FGF23 can be produced by the method of Shimada et al {Endocrinology 143, 3179 (2002)}. Similarly, the klotho protein of the present invention is also produced by appropriately using a known method or a modification method known in the technical field such as a chemical synthesis method, a cell culture method, etc., in addition to the genetic recombination technique. be able to.

The composite of the present invention can also be produced, for example, by the following production method. That is, it can be prepared by mixing the above-mentioned FGF23 and the klotho protein and leaving them to stand at 4 ° C. to room temperature for several minutes to several hours. In order to further strengthen the binding of the complex, a cross-linking agent such as di succ inimidyl suberate and bis (sul fosucc inimidyl) suberate can be used. Also, in addition to the gene recombination technique, a known method known in the technical field such as a chemical synthesis method, a cell culture method, or the like, may be used for the gene linked to the FGF23 and klotho protein. It can be produced by appropriately using a modification method. It can also be produced by purifying an FGF23-klo tho protein complex present in a living body using anti-FGF23 antibody-bound beads or anti-klo tho protein antibody-bound beads. Pharmaceutical composition comprising the klotho protein of the present invention

The klotho protein of the present invention is useful for increasing or decreasing blood phosphate concentration and increasing or decreasing Z or blood activated biminmin D concentration, or for diseases in which increasing or decreasing the action of FGF23 is undesirable. Can be used as a pharmaceutical composition. As in Examples 13, 28 and 29, a pharmaceutical composition containing the present klo tho protein or the present klo tho protein changes blood phosphorus, blood active vitamin D concentration or FGF23 action. A disease that causes changes in blood phosphate levels, blood active vitamin D levels, and FGF23 activity, such as hyperphosphatemia, hyper1,25D blood disease, renal osteodystrophy, Dialysis osteopathy, osteoporosis, renal tubular dysfunction, osteopenia, hypotensive lucidemia, hyperparathyroidism, ectopic calcification, pruritus, osteosclerosis, Paget's disease, hypercalcemia, vice It can be used to treat hypothyroidism, bone pain, muscle weakness, skeletal deformity, and growth disorders. A pharmaceutical composition comprising the anti-klotho protein antibody of the present invention.

As described in Example 14, the antibody of the present invention has the effect of increasing the blood phosphate concentration and the concentration of Z or active vitamin D in the blood and the effect of inhibiting the action of FGF23 in the body. Therefore, it can be used as a pharmaceutical composition for diseases considered to be affected by changes in blood phosphorus and / or active vitamin D concentration, such as neoplastic osteomalacia, ADHR, and XLH. It can be expected to improve hypophosphatemia, bone calcification insufficiency, bone pain, muscle weakness, skeletal deformity, growth disorders, and low 1,25Demia, which are commonly found in these diseases. In addition, FGF-23 plays an important role under physiological conditions, and the antibody of the present invention controls the action of FGF-23 to regulate phosphorus metabolism and the action of FGF-23 to regulate calcium metabolism via vitamin D metabolism In some cases, minerals such as osteoporosis, rickets, hypercalcemia, hypocalcemia, ectopic calcification, sclerosis, Paget's disease, hyperparathyroidism, hypoparathyroidism, and pruritus Teens It can be used therapeutically and prophylactically as a pharmaceutical composition for diseases caused by abnormalities in vitamin X metabolism and vitamin D metabolism. Pharmaceutical composition comprising the complex of FGF23 and klotho protein of the present invention

FGF23 binds to solubilized klotho protein (Example 12), and addition of FGF23 induces intracellular signals (enhanced ERK phosphorylation and increased EGR1 expression) only in the presence of klotho protein (Examples 6, 7, 8) or decreased (Example 13) or increased (Example 13) blood phosphorus and Z or active vitamin D levels in blood in transplantation experiments with solubilized klotho protein-expressing cells. This suggests that FGF23 and klotho protein may alter the concentration of blood phosphorus and / or active vitamin D in the blood by some interaction. Therefore, the complex of the Klotho protein and FGF23 of the present invention can be used as a pharmaceutical composition for diseases in which an increase or decrease in blood phosphate concentration and an increase or decrease in Z or blood activated biminin D concentration are undesirable. It can be used as a product. In other words, diseases that cause changes in blood phosphate concentration and blood active vitamin!) Concentration, such as hyperphosphatemia, hyper1,25D, renal osteodystrophy, dialysis osteopathy, osteoporosis, Renal tubular dysfunction, osteopenia, hypocalcemia, hyperparathyroidism, ectopic calcification, pruritus, bone sclerosis, Paget's disease, hypercalcemia, hypoparathyroidism, bone pain, muscle strength It can be used for treatment of depression, skeletal deformation, growth disorders, etc. Use of the pharmaceutical composition of the present invention

The pharmaceutical composition of the present invention containing the klotho protein, the anti-klotho protein antibody, and the complex of the klotho protein and FGF23 as an active ingredient may contain a pharmaceutically acceptable carrier or additive. Good. Examples of such carriers and additives include water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, lipoxyvinyl polymer, nadridium alginate, water-soluble dextran, sodium carboxymethyl starch, Pectin, xanthan gum, gum arabic, casein, gelatin, agar, glycerin, propylene glycol, polyethylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, la Kutose, a surfactant acceptable as a pharmaceutical additive, and the like. The additives to be used are appropriately or in combination selected from the above depending on the dosage form of the present invention.

The prophylactic or therapeutic agent containing the klotho protein, anti-klotho protein antibody, and complex of klotho protein and FGF23 of the present invention can be administered orally or parenterally.

Instead of administering a complex of Klotho protein and FGF23, it is also effective to administer each protein simultaneously.

In the case of oral administration, solid preparations such as tablets, granules, powders, and pills to be applied thereto, or liquid preparations such as liquids and syrups may be used. In particular, granules and powders can be in unit dosage form as capsules, or in the case of liquid preparations, as dry products to be re-dissolved when used.

Oral solid preparations of these dosage forms usually contain additives such as binders, excipients, lubricants, disintegrants, wetting agents and the like which are generally used in pharmaceutical preparations in their compositions. Oral liquid preparations usually contain additives such as stabilizers, buffering agents, flavoring agents, preservatives, fragrances and coloring agents which are generally used in preparations in their compositions.

When administered parenterally, injections, suppositories and the like can be made.

For injections, they will usually be presented in unit dose ampoules or in multi-dose containers, which may be reconstituted in a suitable carrier, eg, sterile pyrogen-free water, for use. These dosage forms usually contain additives, such as emulsifiers and suspending agents, which are generally used in pharmaceutical compositions. Injection techniques include, for example, intravenous infusion, intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection, and intradermal injection. The dose varies depending on the age of the subject, the route of administration, and the number of administrations, and can vary widely.

In this case, an effective amount of a klotho protein, an anti-klotho protein antibody, a complex of klotho protein and FGF23 of the present invention, an appropriate diluent, and an effective amount administered as a combination with a pharmacologically usable carrier. The amount is 0.01 to 100 g, preferably 0.5 to 20 _g / kg body weight at a time for klotho protein or complex. In addition, in the case of an antibody, the dose is 0.1 lg to 2 mg, preferably 1 to 500 / zg per kg of body weight at a time. Screening system

Abnormalities in blood phosphorus and Z or active vitamin D levels can be caused by a variety of disorders, such as hyperphosphatemia, high 1.25D, renal osteodystrophy, dialysis osteopathy, osteoporosis, low Linemia, keratosis, osteomalacia, tubular dysfunction, osteopenia, hypocalcemia, hyperparathyroidism, ectopic calcification, pruritus, osteosclerosis, Paget's disease, hypercalcemia Blood serum and hypoparathyroidism, bone pain, muscle weakness, skeletal deformity, growth disorders and low 1,25D bloodemia, etc., and blood phosphorus and Z or blood active vitamin D levels It is believed that substances that regulate the disease are useful for the treatment of such diseases. _C The system using the interaction between FGF23 and klotho protein according to the present invention is a substance that treats the above-mentioned diseases (eg, protein, peptide , Carbohydrates, lipids, non-peptidic compounds, Forming compounds, fermentation products, available to explore the biological material). Indicators for searching for such substances include systems that detect intracellular signals due to FGF23-klotho protein interaction (eg, phosphorylation of intracellular proteins, activation of early response genes, intracellular calcium, cAMP, changes in intracellular signaling molecules such as cGMP, changes in cell membrane potential, changes in intracellular pH, release of extracellular signaling molecules, changes in cell morphology, etc.).

For example, FGF23 acts on a cell line expressing the full-length klotho protein and inhibits or enhances the interaction between FGF23 and klotho protein by using a system that confirms that intracellular ERK phosphorylation is enhanced. It is possible to search for such substances (small molecules, antibodies, etc.). In addition, by using a system that confirms that intracellular E phosphorylation is enhanced by adding solubilized klotho protein and FGF23 to various cell lines, the FGF23-klotho interaction (eg, It is possible to search for a substance that inhibits or enhances concentration changes or changes in blood active vitamin D concentration).

In addition, for example, FGF23 is allowed to act on a cell line expressing full-length klotho protein,

Inhibition of FGF23-klo tho protein interaction by using a system that confirms that EGR1 gene expression increases or a system that uses the EGR1 promoter luciferase reporter gene to detect activation of the EGR1 promoter. Search for substances (small molecules, antibodies, etc.) It is. In addition, a system that confirms that the expression of the EGR1 gene is increased by adding solubilized klotiio protein and FGF23 to various cell lines, or that the EGR1 promoter-luciferase reporter is activated every time the EGR1 promoter is activated. FGF23-klo tho protein interaction by using a detection system that uses the overnight gene

It is possible to search for a substance that inhibits or enhances (for example, a change in blood phosphorus level or a change in blood active vitamin D level).

In addition, vitamins that are thought to cause gene expression changes by FGF23-klotho protein interaction]) 1α-hydroxylase gene, vitamin D2-4 hydroxylase gene, and other gene changes by FGF23-klotho protein interaction FGF23-klo tho protein interaction (eg, changes in blood phosphorus levels or active vitamin D levels) by using genes that are thought to cause Changes) can be searched for.

The present invention relates to a method for decreasing or increasing blood phosphorus concentration and Z or blood active vitamin D concentration by administering klo tho protein into the body, and a method for administering anti-klotho protein antibody to the body to reduce blood phosphorus concentration. A method to increase the concentration of active vitamin D in the blood or blood, a method to enhance or inhibit the action of FGF23 by administering klo tho protein to the body, and a method to increase FGF23 by administering anti-k101 ho protein antibody to the body Methods that inhibit the action of 23 are also included. Furthermore, the present invention relates to klotho for the production of a pharmaceutical composition for lowering or increasing blood phosphorus concentration and / or active vitamin D concentration or for enhancing or inhibiting the action of FGF23 in the body. Anti-klotho protein antibodies for protein use and for the production of pharmaceutical compositions for increasing blood phosphorus and / or blood active vitamin]) levels or for inhibiting the action of FGF23 in the body And the use of This description includes part or all of the contents as disclosed in the description and / or drawings of Japanese Patent Application No. 2003-137950, which is a priority document of the present application. BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is a photograph showing the results of RT-PCR analysis of EGR1 gene expression changes in mouse kidney 1 hour and 8 hours after a single administration of human FGF23 recombinant. is there.

Figure 2 shows the results of Western blotting of the changes in ERK protein phosphorylation in mouse kidney at 5 and 10 minutes after a single dose of human FGF23 recombinant. It is.

FIG. 3 is a photograph showing the results of Western blotting analysis of changes in ERK protein phosphorylation 10 minutes after the addition of human FGF23 recombinant to PEAK cells expressing full-length klotho protein.

FIG. 4 shows changes in luciferase activity during stimulation of human FGF23 in PEAK cells transfected with a reporter gene linked to luciferase downstream of the EGR1 promoter together with a klotho expression plasmid.

FIG. 5 is a photograph showing the enhancement of ERK phosphorylation in PEAK cells when human FGF23 was added to the culture supernatant of CHOras clone l cells stably expressing soluble mouse klotho protein in PEAK cells.

Figure 6 shows the results of the mklotho-97 antibody, mklotho-118 antibody, and mklot o-299, which were obtained by using a solubilized mouse klotho protein transiently expressing PEAK rapid cell supernatant sample and a PEAK raid cell culture supernatant sample as a control. 4 is a photograph showing the results of analysis by Western blotting using an antibody and the mklotho-941 antibody.

In Fig. 7, Fig. 7B shows a sample of the supernatant of the solubilized mouse klotho protein transiently expressing PEAK rapid cells, a sample of the culture supernatant of PEAK rapid cells as a control, and the FGF-23-immobilized resin. 4 is a photograph showing the result of analyzing a sample of an FGF-23-conjugated substance subjected to the above by Western blotting using the mklotho-118 antibody or the mklotho-941 antibody. Figure 7A is a photograph showing the result of a similar sample stained by the silver staining method.

Figure 8A shows 1,25-dihydroxyvitamin of the group transplanted with soluble klotho protein-expressing cells (klotho, n = 5) and the group transplanted with control CH0 cells (control, n = 5) on day 14 after cell transplantation. It is a graph which showed D (1, 25D) density | concentration. The results are expressed as the standard error of the mean, and a significant difference test with the control group was performed by Student's st.

Figure 8B shows the serum phosphorus concentration of the group transplanted with the soluble klotho protein-expressing cells (klo tho, n = 6) and the group transplanted with the control CH0 cells (cont rol, n = 6) on day 27 after cell transplantation. 3 is a graph showing serum calcium concentrations. Results are mean soil standard error The significance test with the control group was performed by Student's t. FIG. 9A is a graph showing the serum phosphorus concentration of the anti-klotho protein antibody (P118) group and the vehicle administration group 24 hours after administration.

The results are expressed as mean soil standard errors, and a significant difference test with the control group was performed by Student's st.

FIG. 9B is a diagram showing serum active vitamin D concentrations 9 hours after administration in the anti-klotho protein antibody (pi 18) group and the vehicle administration group.

The results are expressed as the standard error of the mean, and a significant difference test with the control group was performed by Student's st.

Figure 10A shows CHO-FGF23H cell culture supernatant separated by SDS-polyacrylamide gel electrophoresis and detection of recombinant FGF-23 protein and its metabolite by Western blotting with anti-FGF-23 polyclonal antibody It is a photograph taken. In the culture supernatant, there are a full-length FGF-23H protein and an N-terminal fragment and a C-terminal fragment generated by cleavage between SEQ ID NO: 179 and SEQ ID NO: 180 of the amino acid sequence of SEQ ID NO: 35. The hFGF23-48 antibody and the hFGF23-148 antibody recognized the full-length FGF-23H protein and the N-terminal fragment peptide. The presence of small fragmented peptides is observed in the N-terminal fragment. For the anti-His6_tag antibody, full-length protein and C-terminal fragment were detected.

Figure 10B shows that FGF-23 full-length protein purified from CHO-FGF23 cell culture supernatant, N-terminal fragment and C-terminal fragment were separated by SDS-polyacrylamide gel electrophoresis and detected by CBB staining. It is a photograph.

Figure 11 shows the results obtained when the anti-FGF-23 antibody (2C3B) was added during stimulation of human FGF-23 in PEAK cells transfected with a klotho expression plasmid and a reporter gene linked to luciferase downstream of the EGR1 promoter. FIG. 3 is a diagram showing a change in luciferase activity of the present invention. It was shown that luciferase activity increased by FGF-23 stimulation was suppressed by simultaneous addition of 2C3B.

Figure 12 shows whether anti-FGF23 antibody (2C3B) suppresses the increase in ERK phosphorylation caused by the addition of FGF23 and the culture supernatant of CHOras clonel cells, which express soluble klotho protein in CHOras clonel cells. 4 is a photograph showing the results of the measurement. It was shown that the enhancement of ERK phosphorylation when FGF23 and solubilized klotho protein-expressing CHOras clonel cell culture supernatant were added simultaneously was suppressed in a 2C3B antibody concentration-dependent manner. FIG. 13 is a diagram showing the concentrations of phosphoric acid in serum and 1,25-dihydroxyvitamin D in serum 24 hours after administration of the 2C3B antibody, anti-TPO antibody, and vehicle.

FIG. 14 is a photograph showing the purified solubilized klotho after SDS-PAGE and silver staining and detection with an anti-klotho antibody (mklotho-118 antibody).

FIG. 15 is a photograph in which solubilized klotho protein was detected by mastl blotting using mskl antibody-1 and mskl antibody-2.

FIG. 16 is a photograph showing immunoprecipitation of purified solubilized dolot using an anti-mouse klotho monoclonal antibody, and detection of the precipitated solubilized klotho by Western blotting using the fflklotho-118 antibody.

FIG. 17A is a graph showing the effect of mskl antibody-1 on the FGF23 action in the EGR1 Atsushi strain on IS activity.

FIG. 17B is a diagram illustrating the inhibitory effect of the mskl antibody-2 on the FGF23 action in the EGR1 Atsushi system.

FIG. 18A shows the effect of administration of mskl antibody-1 and mskl antibody_2 to mice on serum dihydroxyvitamin D.

FIG. 18B shows the effect of administration of mskl antibody-1 and mskl antibody-2 to mice on serum phosphorus concentration.

FIG. 19 is a graph showing the effect of the anti-klotho monoclonal antibody on FGF23 action in the EGR1 Atsushi strain.

FIG. 2 OA shows the effect of administration of an anti-klotho monoclonal antibody to mice on serum dihydroxyvitamin D concentration.

FIG. 20B shows the effect of administration of an anti-klotho monoclonal antibody to mice on serum phosphorus concentration.

FIG. 21 is a photograph showing the effect of adding purified solubilized klotho and FGF23 on the enhancement of ERK phosphorylation in HEK293 cells. '

FIG. 22 is a photograph showing the effect of the addition of purified solubilized klotho and FGF23 on the cell morphology of MC3T3 cells.

FIG. 23 shows the effect of administering purified solubilized klotho to mice on serum dihydroxybiminin D concentration. FIG. 24A is a diagram in which binding between klotho expressed in HEK293 cells and FGF23 on cells was detected by FACS.

FIG. 24B shows the results of a control in which cells do not express klotho.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described more specifically with reference to examples. However, the technical scope of the present invention is not limited to these examples.

[Example 1] Confirmation of the effect of increasing the expression of egrl in the kidney by administration of FGF23 to mice Human membrane array Atlas mouse 1.2k to search for genes whose expression fluctuates in the kidney when FGF23 is administered to mice , Atlas mouse 1.2kII (Clontech, USA). The membrane array was prepared according to the attached protocol. The samples used were human kidney, human kidney 1 hour after administration of FGF23 (5 / g / head), human

8 hours after administration of FGF23, mouse kidney, vehicle-administered mouse kidney. Production and purification of recombinant human FGF23 was performed according to the method of Shimada et al {Endocrinology 143, 3179 (2002)}.

Mice were performed using BALB / c (male, 6 weeks old) at each n = 2. As a result, EGR1 was found as a gene whose expression increased one hour after administration of human FGF23.

In order to confirm this phenomenon, First strand cDNA was prepared using the above-mentioned three kinds of mouse kidney total RNA, and RT-PCR was performed. First strand cDNA was synthesized using First strand cDNA synthes is kit (Invitrogen, USA) according to the attached protocol. First strand cDNA was prepared using total RNA extracted from mouse kidney 1 hour after administration of human FGF23, mouse kidney 8 hours after administration of human FGF23, and mouse kidney after administration of vehicle. Synthesized.

Using the first strand cMA as type I, and using the mouse EGR1-specific primers shown below (SEQ ID NOs: 4 and 5), 25 cycles of a cycle consisting of 94 ° C for 20 seconds and 68 ° C for 1 minute were performed for 25 cycles. Was carried out.

FW primer for mouse EGR1 RT-PCR: CTTAATACCACCTACCAATCCCAGC (SEQ ID NO: 4) RV primer for mouse EGR1 RT-PCR: GTTGAGGTGCTGAAGGAGCTGCTGA (SEQ ID NO: 5) As shown in FIG. 1, these PCR products were electrophoresed on a 2% agarose gel. However, an increase in EGR1 expression was confirmed only in the mouse kidney one hour after administration of human FGF23. On the other hand, when the target G3PDH primer was used, the same level of expression was observed in all samples. From these results, it was confirmed that 1 hour after the administration of FGF23, EGR1 expression was increased in mouse kidney.

[Example 2] Administration of FGF23 to rats enhances ERK phosphorylation in kidney

It is known that elevated EGR1 expression is caused by activation of the MAP kinase cascade. Therefore, it was examined whether administration of human FGF23 would cause enhanced phosphorylation of ERK in rat kidney. Rats (7 weeks old, SD, male) were administered human FGF23 at a dose of 5 g / head, and the kidneys were removed 5 minutes and 10 minutes later. Only the kidney cortex was cut with a razor. The cut rat kidney cortex was frozen in liquid nitrogen. The frozen kidney was extracted with extraction buffer (20 mM Hepes (pH 7.5), 150πιπ NaCl, 1 NP-40, lmM EDTA, 0.1% SDS, 50niM sodium fluoride, 2mM sodium Vanadate, 1 tab./7ml COMPLETE (US (Roche Co., Ltd.)) and homogenized with a Polytron homogenizer. After standing on ice for 2 hours, the mixture was centrifuged at 1000 G for 10 minutes, and the supernatant fraction was used for subsequent experiments. The protein concentration of the supernatant fraction was measured with a BCA kit (PIERCE, USA), and all samples were prepared with an extraction buffer to a protein concentration of 22.7 mg / ml. This sample was subjected to Wes evening blotting using an anti-phosphorylated ERK antibody (Santa Cruz, USA). As shown in FIG. 2, in the rats to which human FGF23 was administered, it was confirmed that ERK phosphorylation was enhanced after 5 minutes and 10 minutes. [Example 3] Cloning of mouse klotho gene

The full-length cDNA cloning of the mouse kl 01 ho gene was performed by PCR. The following primers were synthesized based on GeneBank data (Accession No. AB005141).

Mouse klotho gene cloning FW primer:

CCCGAATTCGCAGCATGCTAGCCCGCGCCCCTCCTC (SEQ ID NO: 6)

Mouse klotho gene cloning RV1 primers:

ATTTGCGGCCGCTTACTTATAACTTCTCTGGCCTTTCTT (SEQ ID NO: 7)

The primer of SEQ ID NO: 6 contains a primer i? On the 5 'side of the mouse klotho gene, an initiation codon and a Kozak sequence portion of 5 bases upstream thereof. In addition, an EcoRI site has been added.

The primer of SEQ ID NO: 7 is a primer on the 3 'side of the mouse klotho gene, which contains a termination codon and a Not I site. Mouse kidney cDNA for type 錶 It was used. Preparation of mouse kidney cDNA was performed according to the method of Example 1. The PCR reaction used LATaQwithGCBuifer (Yukara, Japan). That is, TaKaRa

La Taq polymerase 0.5 / ^ 1, 2XGC buffer 25 1, dNTP Mix 81 (2.5 mM), primer of SEQ ID NO: 6 (1 / M), primer of SEQ ID NO: 7 (1 M), mouse kidney cDNA Water was added to a final volume of 50 \, and PCR was performed under the following conditions. Primary denaturation at 94 ° C for 5 minutes, then 94 20 seconds, 55 at 30 seconds, 7

One cycle was performed at 2 ° C for 4 minutes for 35 cycles, and finally the extension reaction was performed at 72 ° C for 7 minutes. The amplified product by PCR was confirmed by 0.8% agarose electrophoresis. As a result, a single band was detected at about 3 kbp. The band was cut out from the gel, and a MinElute Gel extraction kit (Qiagen, Germany) was used. Was used to purify the gel. Cut the purified mouse klotho cDNA fragment with EcoRI and NotI,

Ligation was performed on the PEAK8 vector (Edge Biosystems, USA) cut with EcoRI.NotI. The reaction is TaKaRa Ligation Kit version

2 (Yukara, Japan) was performed according to the attached protocol. In order to confirm the nucleotide sequence of the cloned mouse k101ho cDNA,

Based on GeneBank Data (Accession No. AB005141), the following primers for mouse klotho gene sequence confirmation were synthesized.

ACTACCGCTTCTCCATATCGTG (SEQ ID NO: 8)

TCGCCTTAAGCTCCCATTGGAT (SEQ ID NO: 9)

ATGGGGTCGACGTCATTGGGTACA (SEQ ID NO: 10)

TCTTGCCTCTGGGTAACCAGAC (SEQ ID NO: 11)

CTTGCAGGCTGACTGGATAGA (SEQ ID NO: 12)

AGCAAGACTCACTGAGGATCTA (SEQ ID NO: 13)

CACGATATGGAGAAGCGGTAGT (SEQ ID NO: 14)

ATCCAATGGGAGCTTAAGGCGA (SEQ ID NO: 15)

TGTACCCAATGACGTCGACCCCAT (SEQ ID NO: 16)

GTCTGGTTACCCAGAGGCAAGA (SEQ ID NO: 17)

TCTATCCAGTCAGCCTGCAAG (SEQ ID NO: 18)

TAGATCCTCAGTGAGTCTTGCT (SEQ ID NO: 19)

Nucleotide sequence analysis of mouse klotho cDNA cloned using these primers As a result of the analysis, it completely matched the mouse klotho gene, and the cloning of the mouse klotho gene was completed. Hereinafter, this plasmid is referred to as mklotho / pEAK8. In addition, mouse klotho cDNA obtained by digesting the mklotho / pEAK8 'vector with EcoRI and Notl is ligated to plasmid pEAK8 by linking an intramolecular ribosome entry site (IRES) and enhanced green fluorescent protein (EGFP). Mklotho / IRES-EGFP-pEAK8 was obtained by inserting it into EcoRI and Notl sites of the prepared vector IRES-EGFP-PEAK8.

[Example 4] Cloning of gene encoding mouse-solubilized klotho protein The mouse kl01ho gene prepared in Example 3 was solubilized into type II to produce a klotho protein. The following primers were synthesized for production.

RV3 primer for cloning mouse-solubilized klotho protein-encoding gene:

ATTTGCGGCCGCTTAGGTTTGAAAAAATCCACATTCGGTGCA (SEQ ID NO: 20)

The primer of SEQ ID NO: 20 contains up to 2940 bases of the mouse klotho gene, adds a TAA termination codon, and further adds a Notl site. The PCR reaction was carried out using the primers of SEQ ID NO: 8 and SEQ ID NO: 20 and Pyrobest Polymerase (Yukara, Japan). That is, TaKaRa Pyrobest polymerase 0.5 10X Pyrobest Buffer

51, dNTPMi 4 l (1.25 mM), SEQ ID NO: 8 primer 1 M, SEQ ID NO: 20 primer 1 M, mouse klotho cDNA 10 ng were added, and water was added to a final volume of 501. The PCR reaction was performed as follows. Primary denaturation at 94 ° C for 5 minutes, then at 94 ° C

One cycle was 20 seconds, 30 seconds at 55 ° C, and 4 minutes at 72, and 35 cycles were performed. Finally, the extension reaction was performed at 72 ° C for 7 minutes. The amplified product by PCR was confirmed by 0.8% agarose gel electrophoresis.As a result, a single band was observed at about 1.7 kbp.Pand was cut out from the gel, and MinElute Gel extraction kit (Qiagen, Germany) was used. ) Was used for purification from the gel. The purified mouse klotho cDNA fragment was digested with Kpnl and Notl, and the mouse klotho-PEAK8 vector prepared in Example 3 was cut.

-Was digested with KpnI and NotI, and subjected to a ligation reaction. Confirmation of the base SB sequence was performed according to Example 3, and the production of the solubilized mouse klotho protein was completed. Hereinafter, this plasmid is referred to as soluble-mldotho / pEAK8. This solubilized mouse klotho protein encodes amino acids 1 to 980. Furthermore, the obtained mouse solubilized klotho cDNA was digested with EcoRI and Notl, and plasmid pEAK8 (US Edge) BioSystems Inc.) into the EcoRI.NotI site of the vector IES-EGFP-PEAK8, which was created by ligating an intramolecular ribosome entry site (IRES) and enhanced green fluorescent protein (EGFP). A solubl e-mklotho / IRES-EGFP-PEAK8 was obtained.

[Example 5] Production of mouse solubilized klotho protein stably expressing cells

Using Trans IT LT1 (MIRUS, USA), the plasmid-mklotho / IRES-EGFP-pEAK8 plasmid was introduced into CHOras clone cells according to the package insert. G Select drug-resistant cells in α medium containing 5 g / ml pure bitemycin and 10% FBS, and use FACS vantage (Becton Dickinson, USA) to select cells with strong EGFP (Green Fluorescent Protein) emission. Cloned by sorting. When the cloned cells became confluent, the medium was replaced with serum-free DF (DMEM / F-12) medium, and the supernatant was recovered 2 days later. Collect the supernatant using anti-klotho protein antibody

Western blotting was performed using ALPHA DIAGNOSTIC (USA) to select clones with a strong klotho protein band around 130 kDa.

[Example 6] Transient expression of mouse full-length klotho protein enhances ERK phosphorylation upon FGF23 stimulation

Confirmation of enhanced ERK phosphorylation

The mouse full-length klotho protein was transiently expressed in PEAKrapid cells (Edge Biosystems, USA) using the mouse full-length klotho protein expression plasmid prepared in Example 3, and the intracellular ERK phosphorus was stimulated with FGF23. The enhanced oxidation was verified. The mklotho / pEAK8 plasmid prepared in Example 3 was transiently transfected into a 12-well plate according to the protocol attached to the PEAKrapid cells. Trans Hue transfected 2 4 hours later the medium was replaced with DMEM medium without serum, additional 2 4 h (;. 0 ₂ Inkyube Isseki was performed Inkyubeto within one heparin (U.S. sheet Damasha) the 1 O g / ml Then, FGF23, bFGF, and medium were added for 10. After incubation at 37 ° C for 10 minutes, the supernatant was aspirated, washed with PBS, and then washed with SDS-PAGE sample buffer. The cells were lysed at (Daiichi Kagaku, Japan) and Western blotting was performed on this sample in the same manner as in Example 2. As shown in Fig. 3, EGF by FGF23 was used only in mouse full-length klotho protein-expressing PEAKrapid cells. Enhanced phosphorylation was confirmed. [Example 7] Confirmation of increase in egrl expression by FGF23 stimulation by transient expression of mouse full-length klotho protein

The increase in EGR1 expression induced by FGF23 stimulation when the full-length mouse klotho protein was transiently expressed in PEAKrapid cells (Edge Biosystems, USA) was examined. Transfection was performed on PEAK rap id cells in the same manner as in Example 6. Transfection 48 8 hours later, add heparin to 10 g / ml, and add human FGF23

(10 O ng / ml). Thirty minutes after the stimulation, the cells were washed with PBS and suspended using IS0GEN (Nitsubon Gene, Japan). Total RNA was prepared according to the package insert, and RT-PCR was performed in the same manner as in Example 1. Similar to the results of Example 1, in PEAKrapid cells expressing mouse full-length klotho protein, a significant increase in EGR1 expression was confirmed upon stimulation with FGF23 lOOng / ml.

[Example 8] Confirmation of enhanced ERK phosphorylation in CHOras clone l cells by addition of mouse solubilized kl 0 tho protein-expressing cell supernatant and FGF23

8- (1) Preparation of culture supernatant of mouse solubilized klotho protein-expressing cells

The mouse solubilized klotho protein-expressing CHOras clonel cells prepared in Example 5 were seeded in a tissue culture flask (225 cm ² , Corning, USA). After culturing for 24 hours, the medium was replaced with a serum-free ΜΕΜα medium, and the cells were cultured at 37 for 5 days, and the culture supernatant was collected.

8-(2) Enhanced ERK phosphorylation in CHOras clonel cells by adding FGF23 and culture supernatant of mouse solubilized klotho protein-expressing cells

CHOras clone cells and HEK293 cells were seeded on 24-well plates (Coming, USA). After culturing for 24 hours, the culture medium was replaced with the mouse-soluble solubilized klotho protein-expressing CHOras clone cell culture supernatant prepared in 8- (1), and culturing was further performed for 4 hours. Subsequently, 10 g / ml of heparin was added, and then human FGF23 (100 ng / ml) was added. After performing incubation at 10 minutes 37, the supernatant was aspirated, washed with PBS, and lysed with SDS-PAGE sample buffer (Daiichi Kagaku, Japan). Western blotting was performed on this sample in the same manner as in Example 2 using an anti-ERK antibody (Santa Cruz, USA). As shown in FIG. 5, the enhancement of ERK phosphorylation by FGF23 was confirmed only in the cells to which the mouse soluble klotho protein was added. [Example 9] EGR1 Promoter · klotho protein expression using luciferase Acetase in PEAK cells

9- (1) Mouse EGR1 Promoter / Luciferase fusion gene construction

In order to examine the increase in mouse EGR1 gene expression, a mouse EGR1 promoter-luciferase fusion gene was prepared. Cloning of the mouse EGR1 promoter was performed by PCR. Primers were prepared as follows based on the literature (Barbara, A. et al., Proc. Natl. Acad. Sci. USA Vol. 85, pp. 7857-7861).

FW primer for mouse EGR1 promoter cloning:

GGGGTACCAACAGATCCTGGCGGGGACTTAGGAC (SEQ ID NO: 21)

'RV primers for mouse EGR1 promoter cloning:

CCCAAGCTTTCGCGACTCCCCGAATCGGCCTCTATT (SEQ ID NO: 22)

The primer of SEQ ID NO: 21 is a primer starting from the −1023 base portion of the mouse EGR1 promoter, and a Hindlll site is further added. The primer of SEQ ID NO: 22 is a primer including the mouse EGR1 mRNA start site (+1) and has a Kpnl site added thereto. For mouse type マウス, mouse Genomic DNA (Clontech, USA) was used. The PCR reaction was performed using LA Taq GC Buffer (Takara Shuzo, Japan) according to the attached manual. The PCR reaction conditions were as follows: primary denaturation at 94 ° C for 5 minutes, followed by 30 cycles of 94 ° C for 20 seconds, 60 ° C for 30 seconds, and 72 ° C for 1 minute, and finally elongation. The reaction was performed at 72 ° C for 7 minutes. The amplified product by PCR was confirmed by electrophoresis on a 2% agarose gel. As a result, a single band was detected at about lkbp. The band was cut out from the gel, and the GeneClean kit (US Bio 1) was used.

(1 company) and then cut with Hindlll and Kpnl. again

Purification was performed using a GeneClean kit (U.S.A., Bio 101), and ligation was similarly performed with pGL3-Basic (Promega, U.S.A.) cut with Hindlll and Kpnl. The ligation reaction was performed using TaKaRa Ligation kid version 2 (Takara Shuzo, Japan) according to the attached protocol. The nucleotide sequence of the cloned mouse EGR1 promoter was confirmed, and the production of the mouse EGR1 promoter 'luciferase fusion gene was completed. Hereinafter, this plasmid is referred to as mEGRlpromoter_lu / pGL3Basic.

9- (2) Increase in luciferase activity of human EGF1 promoter-stimulated human FGF23 in klotho-expressing PEAK cells using the luciferase repo overnight gene Using the mouse EGR1 promoter and the reporterase reporter gene prepared in 9- (1) above, changes in EGR1 expression of FGR23-stimulated EGR1 in mouse klotho-expressing PEAK cells were examined. Mklotho / pEAK8 prepared in Example 3 and iEGRlpromoter-luc: / pGL3Basic prepared in Example 9- (1) were transfected simultaneously according to the protocol attached to PEAK rapid cells (Edge Biosystems, USA) . The transfection was performed in a 10 cm-diameter culture dish (Becton Dickinson, USA). Four hours after transfection, the cells were detached with PBS containing 0.53 mM EDTA, and seeded on a white 96-well plate (Corning, USA). After culturing for 24 hours, human FGF23 was added at 0 to 10 Ong / ml, and heparin (Sigma, USA) was also added so as to be 10 g / ml. After standing still at 37 ° C for 24 hours, luciferase activity was measured using a Steady-Glo Luciferase assay system (Promega, USA) according to the protocol. The measurement was performed using a TopCount (US-based Pacikido). The results are shown in FIG.

[Example 10] Preparation of anti-mouse klotho protein partial peptide polyclonal antibody

10- (1) Synthesis of peptide corresponding to FGF-23 partial sequence

For the protein part of SEQ ID NO: 23 (mouse full-length klotho protein), using the calculation function of DNASIS Mac Version 7.2, the hydrophobicity was predicted, and a site suitable for peptide antibody production was predicted. From the viewpoint that the degree of hydrophilicity is high and the site is not a site that can be a sugar chain modification or phosphorylation site, a partial sequence that is considered to be more suitable for antibody production was extracted. As a result, peptide mklotlio-97 (SEQ ID NO: 24) with a cysteine residue added to the C-terminal of a peptide consisting of 16 amino acids starting from histidine at residue number 97 in SEQ ID NO: 23, starting from proline at position 118 21 Peptide mklotho-118 (SEQ ID NO: 25) with a cysteine residue added to the N-terminus of the peptide consisting of amino acid residues, peptide mklotho-299 (SEQ ID NO: 26) consisting of 20 amino acid residues starting from alanine at position 299, A peptide mklotho-941 (SEQ ID NO: 27) consisting of 25 amino acid residues starting from the 941th proline was selected as an antigen and chemically synthesized.

mklotho-97: HHSGAAPSDSPIVVAPC (SEQ ID NO: 24)

mklotho- 118: CPPLSSTGDVASDSYNNVYRDT (SEQ ID NO: 25) mkl ot o-299: ALSS-INPR TDYNIREC (SEQ ID NO: 26)

mkl ot o-941: PSMKHYRKI IDSNGFLGSGTLGRFC (SEQ ID NO: 27)

10— (2) Preparation of polyclonal antibody against anti-FGF-23 partial peptide

All of the above-mentioned peptides were bound to carrier protein ゥ -thyroglobulin via their cysteine residues and subjected to immunization. Immunization was performed using two egrets for one antigen peptide. In the first immunization, a peptide conjugated to lOO g of a carrier protein per bird was emulsified with Freud's complete adjuvant and administered intradermally or subcutaneously to a egret. One week after the first immunization, a peptide conjugated to lOO g of the carrier protein was emulsified with incomplete Freund's adjuvant and administered similarly. The same administration was performed six times at two-week intervals, and one week after the final administration, whole blood was collected to prepare an antiserum.

ゥ To prepare an affinity column for purifying antibodies against partial peptides of the anti-mouse klotho protein from heron serum, each peptide used for immunization was gel-prepared using SulfoLink Kit (PIERCE, USA). Was immobilized. Antiserum was added to this column using PBS (-) as an adsorption buffer, and the antibody that binds to the peptide used for immunization was retained on the column. Next, the antibody bound to the column was eluted and recovered using a 0.1 M glycine buffer (pH 2.8) as an elution buffer. The eluted fraction was adjusted to around pH 7.2 by adding 1M Tris-HCl (H 9.0). The prepared antibody solution was applied to a gel filtration column NAP25 (Amersham Pharmacia Biotech, USA) to replace the buffer with PBS (-), and then a membrane filter with a pore size of 0.MILLEX-GV (Mill, USA) The solution was sterilized by filtration using ipore) to obtain antibodies against each peptide. The concentration of the purified antibody was calculated by measuring the absorbance of 280 dishes and setting lmg / ml to 1.350D. Each of the purified antibodies thus obtained will be indicated using the name of the peptide used for immunization. For example, an antibody obtained by immunizing the mklotho-97 peptide of SEQ ID NO: 24 will be referred to as a mklotho-97 antibody.

10— (3) Recognition of mouse kl otho protein by anti-mouse klotho protein partial peptide antibody

Using the mklotho-97 antibody, mklotho-118 antibody, mklotho-299 antibody, and mklotlio_941 antibody obtained by the above method, the mouse solubilized klot o protein transiently expressed PEAK rapid cell supernatant prepared in Example 8 Mouse solubilization in mouse The protein was analyzed by Western plotting. As shown in FIG. 6, mouse-solubilized k-lotho protein near 130 kDa was detected for all antibodies. Therefore, these four types of antibodies were found to be antibodies that can recognize mouse klotho.

Example 11 Preparation of Piotin-Labeled Antibody

Piotin labeling was performed using polyclonal antibodies against the above-mentioned purified four partial peptides of the mouse klotho protein. To 1 ml of antibody solution diluted to lmg / ml with 50mM sodium bicarbonate solution, add 10l of a solution of Biotin-AC5-Osu (Dohin Chemical Co., Japan) dissolved in dimethylformamide at a concentration of 1.82mg / il. The mixture was added and mixed by inversion at 4 ° C for 2 hours. Then, this reaction solution was applied to a NAP10 column (Amersham Pharmacia Biotech, USA) to remove unreacted Biotin-AC5-Osu, and the solvent was replaced with PBS (-). A partial peptide polyclonal antibody was obtained.

[Example 1 2] Binding experiment between FGF-23 and klotho protein

The binding of the FGF-23 protein to the klotho protein was confirmed by the following experiment.

12- (1) Preparation of FGF-23-immobilized resin-Preparation and purification of recombinant FGF-23RQH were performed according to Example 15 described later. This purified product was immobilized on NHS-activated Sepharose 4FF (Amersliam Pharmacia Biotech, USA) in a usual manner at 3.3 mg per 1 ml of resin.

12- (2) Binding of solubilized klotho protein to FGF-23RQH-immobilized resin

8 ml of the solubilized mouse klotho protein transiently-expressed PEAK rap id cell supernatant prepared in Example 8 or the parental PEAK rap id cell supernatant as a control,

FGF-23-immobilized resin (50 ^ 1) was added, and the mixture was inverted at 4 ° C for 1 hour to react the solubilized mouse klotho protein with FGF-23. Thereafter, the resin was washed four times with PBS to remove unreacted substances. 300 1 sample buffer (50 mM

Tris-HCl pH 6.8, 0.4% SDS, 6% glycerol, 0.002% bromphenol blue,

After adding 2% i3 mercaptoethanol) and heating at 95 ° C for 5 minutes, the supernatant obtained by centrifugation was collected. Western blotting of these supernatants and cell supernatants using the mklotho-118 and mklotho-941 antibodies obtained in Example 10 Analysis was performed by the method. Figure 7 shows the results. Fig. 7 also shows the results of silver staining of a similar sample using 2D-silver staining reagent II II (Daiichi Chemical Co., Ltd., Japan). 'These results indicated that the solubilized mouse klotho protein was bound to the FGF-23RQH-immobilized column and concentrated. Therefore, it was clarified that FGF-23 binds to klotho protein.

[Example 13] Transplantation test of solubilized klotho protein-expressing CH0 cells

13- (1) Examination of serum 1,25 dihydroxyvitamin D concentration

In order to examine the biological activity of the solubilized klotho protein recombinant, the solubilized klotho protein recombinant stably expressed CH0 cells obtained in Example 5 were subcutaneously implanted into nude mice to obtain the solubilized klotho protein recombinant. A mouse model for high expression of solubilized klotho protein, which retains tumors derived from transplanted cells that secrete constantly, was created. Seven-week-old male BALB / c nude mice were used as experimental animals, and cell transplantation was performed as follows. Mice were kept in plastic cages throughout the period from their arrival to dissection and were allowed free access to commercially available rodent chow and tap water.

Solubilized klotho protein-expressing CH0 cells and the parental CH0 cells as a control were each dispersed in PBS buffer at 1 × 10 ⁸ cells / mL, and these cell suspensions were subcutaneously subcutaneously at the back of nude mice at two locations. 0.1 mL each was injected into the control group (control CH0 cell transplantation group n = 5, solubilized klotho protein-expressing CHO cell transplantation group n = 5). On day 14 after cell transplantation, blood was collected by cardiac blood sampling under ether anesthesia, and serum was prepared using Microtina (Becton Dickinson, USA). The 1,25-dihydroxyvitamin D concentration in the obtained serum was measured using a 1,25 (0H) 2D RIA kit (TFB, USA).

As a result, the concentration of 1,25-dihydroxyvinylamine in the group transplanted with the soluble klotho protein-expressing cells was significantly lower than that in the group transplanted with the control CH0 cells (FIG. 8). 13- (2) Examination of serum phosphorus concentration

In the same manner as above, solubilized klotho protein-expressing CH0 cells and control CH0 cells were subcutaneously transplanted into 5-week-old male BALB / c nude mice (control CH0 cell transplantation group n = 6, solubilized The serum phosphorus concentration on day 27 of the klotho protein-expressing CHO cell transplant group n = 6) was measured using Pitest Corporation (Wako Pure Chemical, Japan).

As a result, as shown in FIG. 8, the sera of the solubilized klotho protein-expressing cell transplant group Phosphorus concentration is significantly lower than that of control CH0 cell transplant group.

From the above results, it was proved that the solubilized klo tho protein recombinant had a physiological activity to reduce serum phosphorus concentration and 1,25 dihydroxyvitamin D concentration. This activity is similar to that of previously reported FGF-23. [Example 14] Phosphorus and Vitamin D Elevating Effect by Administration of Anti-klotho Protein Antibody to Mice

BALB / c, male, 7-week-old normal mice were intraperitoneally administered once with the anti-klotho protein antibody P118 obtained in Example 10 at 200 g / O. 2 mL / mouse. To the control group, 0.2 mL of the solvent (PBS) was intraperitoneally administered. Nine hours after administration, blood was collected from the orbit using a glass capillary, serum was separated using Microtina (Becton Dickson, USA), and 24 hours later, blood was collected from the abdominal vena cava, using Microtina again. To separate the serum. Nine hours after the obtained serum, the concentration of 1,25-dihydroxyvitamin D was measured using a 1,25 (0H) 2D RIA kit “TFB” (TFB, Japan). The serum phosphate concentration 24 hours later was determined using Phosphor-Test II Co. (Wako Pure Chemical Industries, Japan) according to the package insert. The anti-klotho protein antibody and the control group consisted of 6 mice each, and were supplied with tap water and a solid diet containing 1.03% inorganic phosphate and 1.18% calcium CE2 (CLEA Japan, Japan). They were allowed free intake.

As a result, the 1,25-dihydroxyvitamin 9 9 hours after administration of the P118 antibody and the serum phosphate concentration 24 hours after administration were significantly higher than those in the vehicle-administered group (FIG. 9).

From the above results, it was shown that the anti-klotho protein antibody can increase the serum phosphorus concentration and the serum activated vitamin D concentration.

Example 15 Acquisition of FGF-23, FGF-23H, and FGF-23RQH Proteins

15-(1) Construction of FGF-23H protein expression vector

The cDNA coding for FGF-23 was derived from a cDNA library of the tumor responsible for neoplastic osteomalacia, type III, using the FlEcoRI primer (SEQ ID NO: 28), the LHisNot primer (SEQ ID NO: 29), and LA- After incubating at 96 ° C for 1 minute using Tad DNA polymerase,

Amplification was performed by performing 35 cycles of PCR, in which a cycle consisting of 30 seconds at 55, 30 seconds at 55, and 30 seconds at 72 ° C was one cycle. The FlEcoRI primer anneals to a sequence located further 5 ′ upstream of the nucleotide sequence encoding FGF-23, and Add an EcoRI restriction enzyme site 5 'to the region encoding FGF-23. The LHisNot primer is a sequence that anneals to the sequence 5 'of the stop codon of the sequence encoding FGF-23 and the sequence following the sequence that encodes the His6_tag sequence (His-His-His-His-His-His-His). Contains Don and Notl restriction enzyme sequences. As a result, the amplified fragment encodes the FGF-23 protein with a His6-tag sequence added to the C-terminus, and has a Notl restriction enzyme site downstream. This amplified fragment was digested with EcoRI and Notl, and ligated to pcDNA3.lZeo (Invitrogen, USA), which was an animal cell expression vector similarly digested with EcoRI and Notl. The expression vector thus prepared was cloned, and its nucleotide sequence was determined. It was confirmed that the FGF-23 protein protein to which the desired His6-1-ag sequence had been added was encoded. This vector is called pcDNAFGF-23H. FlEcoRI: CCGGAATTCAGCCACTCAGAGCAGGGCACG (SEQ ID NO: 28)

LHisNot: ATAAGAATGCGGCCGCTCAATGGTGATGGTGATGATGGATGAACTTGGCGAA (SEQ ID NO: 29)

15- (2) Construction of FGF-23 protein expression vector

After incubating pcDNA / FGF-23H for type I with FlEcoRI primer, LNot primer (SEQ ID NO: 30) and LA-Tan DNA polymerase for 1 minute at 94 ° C, 30 seconds at 94 ° C and 55 ° C Amplification was performed by performing 25 cycles of PCR, with one cycle consisting of 30 seconds and 72 minutes 1 minute. After completion of the reaction, the end of the PCR product is blunted with T4 DNA polymerase (Roche, Switzerland), and then the FGF-23 protein is phosphorylated with Polynucleotide kinase '(Roche, Switzerland) to convert the FGF-23 protein. An encoding cDNA fragment was prepared. Expression vector pCAGGS (Niwa H, et al., Gene. 1991, 108: 193-199) was digested with EcoRI, blunt-ended with Klenow fragment (Roche, Switzerland), and the small intestine alkaline phosphatase ( Dephosphorylation was performed using Takara Shuzo, Japan. The thus prepared cDNA fragment encoding FGF-23 was ligated to the pCAGGS vector. The expression vector thus prepared was cloned and its nucleotide sequence was determined to confirm that the sequence encoding the desired FGF-23 protein was correctly inserted. This vector is called pCAGGS / FGF-23.

The FGF-23-encoding fragment amplified with the FlEcoRI and LNot primers was digested with EcoRI and Notl and purified. This is the expression vector

Intramolecular ribosome entry sequence (IRES) in PEAK8 (Edge Biosystem, USA) And the enhanced green fluorescent protein (EGFP) were ligated and inserted into the EcoRI and Notl restriction enzyme sites of the PEAK8 / IRES / EGFP vector and cloned. The nucleotide sequence of the obtained plasmid was determined, and it was confirmed that it encodes the FGF-23 protein. This vector is called PEAK8 / IRES / EGFP / FGF-23.

LNot: ATAAGAATGCGGCCGCTCAGATGAACTTGGCGAA (SEQ ID NO: 30)

After pCAGGS / FGF-23 was linearized by digestion with EcoRI, the ends were blunted using a Klenow fragment (Roche, Switzerland). This was further digested with BamHI, and a DNA fragment containing FGF-23 cDNA was separated and purified by agarose electrophoresis. After digesting the expression vector INPEP4 with Bglll, the ends were blunt-ended using a Klenow fragment (Roche, Switzerland). After digestion with BamHI, the vector was purified by agarose gel electrophoresis. The fragment containing the FGF-23 cDNA was ligated to a vector. The expression vector thus prepared was cloned and its nucleotide sequence was determined to confirm that the sequence encoding the desired FGF-23 protein was correctly inserted. This vector is called INPEP4 / FGF-23.

15- (3) Construction of FGF-23RQH protein expression vector

The FGF-23 protein was found to be susceptible to protein cleavage between the Arg residue at position 179 and the Ser residue at position 180. The N-terminal amino acid sequence at this cleavage site is Argl76-Hisl77-Trl78-Argl79 (SEQ ID NO: 31) corresponding to the Arg-XX-Arg sequence, which is a recognition sequence of the protein converting enzyme. Is known to be a substitution mutation at the 176th or 179th Arg residue. Therefore, we developed a model for the mutant FGF-23 found in ADHR that has resistance to cleavage by protein converting enzyme, has a His6-tag at the C-terminus, and removes the 176th and 179th Arg residues from the Gin residue. A vector was constructed to experimentally produce a mutant FGF-23 protein (hereinafter referred to as FGF-23RQH) substituted with a group.

For the preparation method, RQF (SEQ ID NO: 32), which is a forward primer containing a base substitution sequence for substituting Arg with Gin, and RQR (SEQ ID NO: 33), a reverse primer, were synthesized.

Furthermore, in combination with this base substitution primer, the 5 'and 3'

ME1 (SEQ ID NO: 34) and HNt (SEQ ID NO: 35), which are primers for amplifying the FGF-23 sequence, were prepared. ME1 contains the start codon encoded by the FGF-23 cDNA HNt can insert a His6-tag sequence-encoding codon sequence before the stop codon encoded by FGF-23 cDNA, and add a Notl restriction enzyme sequence. The reverse primer can be.

RQF: ATACCACGGCAGCACACCCAGAGCGCCGAG (SEQ ID NO: 32)

RQR: CTCGGCGCTCTGGGTGTGCTGCCGTGGTAT (SEQ ID NO: 33)

ME1: ATGAATTCCACCATGTTGGGGGCCCGCCTCAGG (SEQ ID NO: 34)

HNt: ATGCGGCCGCCTAATGATGATGATGATGATGGATGAACTTGGCGAAGGG (SEQ ID NO: 35)

Using 10 ng of pGAGGS / FGF-23 as type II, PCR reaction was performed with primers (200 nM each) of the combination of RQF and HNt and the combination of ME1 and RQR. The reaction was carried out using pfu DNA polymerase (Promega, USA) at 94 ° C for 1 minute, followed by one cycle consisting of 94 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute. 25 cycles were performed. The two kinds of reaction solutions thus obtained were diluted 10-fold, and 1/21 of each was mixed to form a 铸, and ME1 and HNt were added to a final concentration of 200 nM. Prepare a PCR reaction solution, incubate at 94 ° C for 1 minute, and perform 25 cycles of PCR reaction consisting of a process consisting of 30 seconds at 94 ° C, 30 seconds at 55 ° C, and 1 minute at 72 ° C. Carried out. Here, LA Ta 丽 A polymerase (Takara Shuzo, Japan) was used. The obtained amplification product of about 800 bp was digested with EcoRI and Notl, and then purified to obtain an insert DNA. The EcoRI and Notl restriction of the PEAK8 / IRES / EGFP vector, in which an intramolecular liposome entry sequence (IRES) and enhanced green fluorescent protein (EGFf) are linked to the expression vector PEAKS (Edge Biosystem, USA). It was inserted into the enzyme site and cloned. The nucleotide sequence of the obtained plasmid, whose sequence is determined and encodes the mutant FGF-23 protein with the desired Arg at positions 176 and 179 converted to Gin and a His6-tag sequence added to the C-terminus I was sure that . This vector is called PEAK8 / IRES / EGFP / FGF-23RQH.

15- (4) Obtaining FGF-23H-expressing cells, FGF-23-expressing cells, and FGF-23RQH-expressing cells,

(i) Obtaining FGF-23H-expressing cells

About 20 g of pcDNAFGF-23H in the ampicillin resistance gene in the vector

It was cut at the Fspl restriction enzyme site, linearized, and purified. Dissolve this in 10 1 pure water,

One cell contains 107 (^ 01 ^ 5 (10116-1 cells (Shirahata, S., et al. Biosci Biotech Biochem, 59: 345-347, 1995), and the gene was introduced into cells by electroporation using Gene Pulser II (Bio Rad, USA). After culturing the cells for 24 hours in a MEM ο; culture medium (Gibco BRL, USA) containing 10% FCS, add Zeocin (Invitrogen, USA) to a final concentration of 0.5 mg / ml for 1 week Cultured. The cells that adhered and proliferated were released with trypsin and cloned by the limiting dilution method in the presence of Zeocin at a final concentration of 0.3 mg / ml to obtain 35 cloned cells. In these cells

Cells that best expressed FGF-23H protein were identified by Western blotting as described below. After collecting the culture supernatant of each cloned cell and performing SDS-polyacrylamide electrophoresis, the protein was transferred to a PVDF membrane (Millipore, USA), and an anti-His-tag (C-terminal) antibody (US, Invitrogen) and an ECL luminescence system (Amersham Pharmacia Biotech, USA) were used to detect a signal derived from the FGF-23H protein of about 32 kDa. As a result, the highest expression was observed in the clone named # 20, which was named CH0-0ST311H and was filed on August 11, 2000 by the National Institute of Advanced Industrial Science and Technology, the Patent Organism Depositary Center (Japan). Deposited at Tsukuba, Higashi 1-chome, 1-1, Chuo No. 6), Ibaraki, Japan (Accession number: FERM BP-7273). In this specification, CH0-0ST311H is referred to as CHO-FGF23H.

(ii) Obtaining FGF-23 and FGF-23RQH expressing cells

The PEAK8 / IES / EGFP / FGF-23 and EAK8 / IRES / EGFP / FGF-23RQH vectors were introduced into CH0 Ras clone-1 cells by the gene transfer method using membrane fusion lipid. Culture CHORas clone-1 cells in a 6-well plate so that the cells cover about 60% of the bottom surface. Then remove the culture medium and add 1 ml of serum-free ΜΕΜα culture medium. Introduce 2.5 g Yuichi and IO Transfectam (registered trademark) (Promega, USA)

The mixture was mixed with 50 ^ 1 serum-free ΜΕΜα culture medium, mixed, and allowed to stand for 10 minutes. Then, both were mixed and added to a prepared 6-well plate. After culturing for 2 hours, the culture solution containing the DNA was removed, replaced with a culture solution containing 10% FCS, and cultured overnight. The next day, drug-resistant cells were selected by adding Puromycin (Sigma, USA) to a final concentration of S ^ g / ml. The drug-resistant cells thus obtained were cloned by the limiting dilution method in the same manner as in the above-mentioned acquisition of FGF-23H-expressing cells. Furthermore, a cell line that best expresses the target protein was obtained by western blotting. These cells are called CH0-FGF23 and CH0-FGF23RQ, respectively. (iii) Purification of recombinant protein

When the recombinant in the culture supernatant of CH0-FGF23H was detected by Western blotting using an antibody against the His6-tag sequence at the C-terminus, a band around 32 kDa and a band near lOkDa were observed as shown in Figure 10A. A band was observed. When these two bands were cut out of the gel and the amino acid sequence at the N-terminal side was determined, the band with the larger molecular weight detected the amino acid sequence from the 25th position in SEQ ID NO: 36, and was secreted from the FGF-23 protein during secretion. It was considered that the signal sequence had been removed. On the other hand, the band with a small molecular weight confirmed the amino acid sequence from the 180th position of SEQ ID NO: 36, and was found to be a fragment generated by cleavage between the 179th position and the 180th position. In addition, by using a polyclonal antibody recognizing the N-terminal side of FGF-23, the presence of a peptide thought to have a sequence up to the 179th position was also confirmed.

After centrifuging 1000 ml of the culture supernatant of CHO-FGF23H cells at 200 g for 15 minutes at 4 ° C to remove the suspended cells, the supernatant was packed into a column of 30 t ID x 200 mm length SP- sepharose FF (Registered trademark) (Amersham Pharmacia Biotech, U.S.A.), a peptide having His6-tag added to the peptide corresponding to positions 180 to 251 of SEQ ID NO: 36 passed through, and passed through 25 to 251. The sixth peptide (hereinafter, sometimes referred to as full-length FGF-23 protein) with a His6-tag sequence added was adsorbed to the column. When the adsorbed material was eluted with 50 mM sodium phosphate buffer (pH 6.7) with a NaCl concentration gradient of 0 to 0.7 M, the eluate was eluted with approximately 0.3 M NaCl. In this fraction, the full-length FGF-23 protein with His6-tag added was observed, and in the fraction eluted at about 0.4M, a peptide thought to have an N-terminal sequence from the 179th position of SEQ ID NO: 36 was found. confirmed. The fraction thus separated on the SP-Sepharose column was then further separated by applying to a metal affinity column, Tal on Superilow (registered trademark) (Clontech, USA). The N-terminal sequence from the 179th position also had an affinity for the metal column and was effective for purification. Furthermore, purification was performed using an SP-Sepharose column, and it was possible to obtain full-length FGF-23H as a single band by CBB staining. The result is shown in FIG. 10B.

The FGF-23 protein can be purified in a similar manner. The culture supernatant of CH0-FGF23 was purified using SuperCap (registered trademark), a membrane having a pore size of 0.2 m (Pall, USA).

Gel-man Laboratory), and the filtered solution is SP- Sepharose FF (US, Amersham Pharmacia Biotech). Substances with low affinity for the column were washed and eluted with 50ιηΜ sodium phosphate buffer, ρΗ6.7. When the protein retained on the column was eluted with a gradient of NaCl from 0 to 0.7Μ, full-length FGF-23 protein was observed in the fraction eluted with about 0.3 M NaCl. This was adsorbed to Talon Superilow (registered trademark) (Clontech, USA), a metal affinity column, washed with 50 mM sodium phosphate buffer, pH 6.7, and then the concentration of Imidazole was changed. And the protein was eluted and purified. Further, the fraction containing the target protein was adsorbed and eluted on a SP Separose FF column and purified. In the same manner, full-length FGF-23RQ protein was purified from the CHO-FGF23RQ supernatant.

[Example 16] Obtaining human monoclonal antibody-producing hybridoma against human FGF-23

The preparation of the monoclonal antibody in this example was prepared according to a general method as described in "Introduction to Monoclonal Antibody Experimental Procedures" (written by Tamoe Ando et al., Published by Kodansha 1991). BALB / c mice were used as immunized animals, and human FGF-23 was immunized by the following two methods depending on the difference in immunogen.

16- (1) Immunization by a combination of single vector administration and recombinant protein administration

The INPEP4 / FGF-23 vector prepared in Example 15- (1) (10 or

50 g / EE) was transvenously introduced with Trans IT (registered trademark) In Vivo Gene Delivery System reagent (Takara Shuzo Co., Ltd., Japan) to perform the first immunization. The same vector from the first immunization

One week later, it was introduced once and boosted. Further, the FGF-23RQH protein (20 to 30 g / animal) prepared in Example 15- (4) was suspended in RIBI adjuvant (Corixa, USA) containing squalene, Tween80, Monophosporyl lipid A and Trehalose dimycolate, and emulsion was added. Was prepared, and boosted four or five times by intraperitoneal injection, and the FGF-23H protein (18 g / animal) prepared in Example 15- (4) four days before the acquisition of the following spleen cells ) Was immunized by tail vein injection.

16- (2) Immunization using human FGF-23

Was it prepared in Example 15- (4) for BALB / c mice? 6? -23 (22 / animal) were suspended in the above-mentioned 81 adjuvant and primed by intraperitoneal injection. In addition, the same protein was boosted once a week by intraperitoneal injection for 4 weeks, and FGF-23 (10 zg / animal) was immunized by tail vein injection 3 days before the acquisition of spleen cells described below. . 16- (3) Preparation and selection of high prioma

The spleen was excised from the mouse immunized as described above, and the spleen cells collected from the spleen were mixed with mouse myeloma SP2 / 0 (ATCC: CRL 1581) at a ratio of 5: 1, and polyethylene glycol 1500 (Roche, Japan) was used as a fusion agent. The cells were fused using Diagnostics, Inc. to produce hybridomas. The selection of hybridomas was carried out using a HAT medium containing HAT containing 10% fetal calf serum (Fetal Calf SermiK FCS) and hypoxanthine (H), aminopterin (A) and thymidine (T) (US , Gibco BRL). Furthermore, cloning was performed by a limiting dilution method using HT-containing DMEM medium. A cloned hybridoma derived from a single cell was obtained. 16- (4) Selection of cloned hybridoma producing anti-FGF-23 antibody

By examining the binding property between the antibody produced by the hybridoma and the FGF-23 protein, the hybridoma producing an antibody that specifically recognizes the FGF-23 protein was selected. The selection of hybridomas obtained by immunization according to the first method described above was carried out as follows. Diluted to a concentration of 1 zg / ml in a solution of 50 mM NaHCO ₃ FGF the 23H protein solution, a 96-well microplate for ELISA (Maxisorp (TM), USA, Nunc, Inc.) was added in 50 1 in each Ueru of 37 Incubate for 30 minutes at ° C or 12 hours at 4 ° C,

The FGF-23H protein was adsorbed on the microplate. The solution was then removed and each well was filled with a blocking reagent (SuperBIock® Blocking Buf fer, USA,

(PIERCE) and incubate at room temperature for 30 minutes.

The plate was washed twice with Tris-buf fered saline containing Tween20 (TRIZMA pre-setcrys tals (registered trademark, Sigma, USA) containing 500 mM NaCl) (T-TBS). To each well of the microplate coated with the FGF-23H protein in this manner, 50 1 of the culture supernatant of each hybridoma was added and reacted for 30 minutes. Then, each well was washed twice with T-TBS. Then, a peroxidase-labeled goat anti-mouse IgG antibody (Zymed Laboratories, USA) diluted 3000-fold to 50: 1 was added to each well, and incubated at room temperature for 30 minutes. After washing the plate three times with T-TBS, 50 1 of a substrate buffer containing tetramethylbenzidine (Denmark, DAK0) was added to each well, and the mixture was incubated at room temperature for 15 minutes. Then, 0.5 M sulfuric acid was added to each well at a rate of 50 1 to stop the reaction. The absorbance at a wavelength of 450 nm was measured using a microplate reader (MTP-300, Corona Electric, Japan) with a reference wavelength of 570 nm. Where the clear absorbance The hybridoma showing the rise was selected, and a similar experiment was performed using FGF-23 protein to select a clone in which the binding to FGF-23 was reconfirmed. As a result, nine clones were obtained as hybridomas producing antibodies recognizing the FGF-23 protein. These included 1C3H, 1D6A, 2A2B, 2C3B, and 2C5L, which will be described later. The selection of hybridomas obtained by immunization according to the second method described above was carried out as follows. Diluted in a solution of 50 mM NaHCO ₃ to a concentration of l / ig / ml FGF- 23 protein solution,

Add 50 il to each well of a 96-well microplate for ELI SA (Maxisorp (registered trademark), Nunc, USA) and incubate at 4 ° C for 10 hours to allow the FGF-23 protein to adsorb to the microplate. Was. Next, the solution was removed, a blocking reagent (SuperBIock (registered trademark) Blocking Buf fer, Pierce, USA) was added to each well, and the mixture was incubated at room temperature for 30 minutes. Was washed twice with Tris-buf fered saline (T-TBS) containing Tween20. To each well of the microplate coated with FGF-23 protein in this manner, add 50 1 of the culture supernatant of each hybridoma and react for 30 minutes.After that, each well contains 0.1% Tween20. Washed twice with Tris-bui iered saline (T-TBS). Next, peroxidase-labeled goat anti-mouse IgG antibody (Zymed Laboratories, USA) diluted 3000-fold was added to each well, and incubated at room temperature for 30 minutes. After washing the plate three times with T-TBS, 50 ml of a substrate buffer containing tetramethylbenzidine (DAK0, Denmark) was added to each well, and the mixture was incubated at room temperature for 15 minutes. Next, 0.5 M sulfuric acid was added to each well to stop the reaction. The absorbance at a wavelength of 450 ηιη was measured using a microplate reader (MTP-300, Corona Electric, Japan) with a reference wavelength of 570 nm. Here, hybridomas showing a clear increase in absorbance were selected. Thus, four new clones were obtained as hybridomas producing antibodies recognizing the FGF-23 protein. This included 3C 1E.

The subclass of the antibody specifically recognizing the FGF-23 protein obtained in this manner was identified using an Isotrip mouse monoclonal antibody isotyping kit (Roche, USA). The results are shown in Table 1. Anti-human FGF-23 antibody

1D6A IgG1 (/ c) 3.21

2A2B IgG1 (/ c) 2.67

2C3B IgG1 (/ c). 1.21

3C1E IgG1 (/) 3.5 or more

2C5L IgG1 (/) 1.38 Of the above hybridoma clones, three hybridoma clones, 2C3B, 3C1E, and 1D6A, were obtained on December 26, 2001 by the National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary Center (Ibaraki, Japan). Based on the Budapest Treaty, an international deposit was made at Higashi 1-chome, 1-chome, 1-Chuo 6). Based on the Budapest Treaty, the Hybrid Maclone 2C5L was registered on January 6, 2003 with the National Institute of Advanced Industrial Science and Technology (AIST) at the Patent Organism Depositary Center (1-1 1-1 Higashi 1-Chuo 6th, Tsukuba City, Ibaraki Prefecture). Deposited. The accession numbers are as follows.

2C3B: FERM BP-7838

3C 1E: FERM BP-7839

1D6A: FERM BP-7840

2C5L: FERM BP-8268

[Example 17] Preparation of monoclonal antibody

17- (1) Preparation of culture supernatant containing anti-FGF-23 antibody

The anti-FGF-23 antibody-producing hybridoma was ligated with 10 g / ml of periinsulin (Sigma, USA), 5.5 g / ml of human transferrin (Sigma, USA), and 0.1 lmM of ethanolamine ( Adapted to eRDF medium (Farto Pharmaceuticals, Japan) containing 5 ng / ml sodium selenite (Sigma, USA). Culture of the eight hybridomas to prepare antibodies was performed in spinner flasks. The culture solution was passed through a filter having a pore size of 0.2 Xm (Pall Gelman Laboratory, USA) to remove foreign substances such as hybridomas, and the antibody-containing culture supernatant was recovered.

17- (2) Purification of monoclonal antibody using protein G

The culture supernatant containing the anti-FGF-23 antibody was applied to a protein G Sepharose 4 FF column (US,

The antibody was adsorbed onto the column through Amersani Pharmacia Biotech) and eluted with 0.1 M glycine buffer (PH2.8). The eluted fraction is added with 1 M Tris_HCl. The pH was adjusted to 7.2. The antibody solution thus prepared was subjected to dialysis substitution with PBS (-) using a membrane with a cut-off molecular weight of 10,000 cuts (Spectrum Laboratories, U.S.A.), and a 0.22 m membrane filter MILLEX- The solution was sterilized by filtration with GV (Millipore, USA) to obtain a purified anti-FGF-23 antibody. The concentration of the purified antibody was calculated by measuring absorbance at 280 nm and setting lmg / ml to 1.350D.

17- (3) Purification of monoclonal antibody using protein A

Using a protein A carrier column (Immune Biological Laboratories, Japan), glycine buffer (pH 8.9) as the adsorption buffer, and citrate buffer (pH 4.0) as the elution buffer, anti-FGF- The antibody was affinity purified from the culture supernatant containing the 23 antibody. 1M Tris-HCl was added to the eluted fraction containing this antibody to adjust the pH to around 7.2. Next, the solution containing the antibody was replaced with PBS (-) using a dialysis membrane, and further sterilized by filtration with a membrane filter having a pore size of 0.22 m to obtain a purified anti-FGF-23 antibody. The concentration of the purified antibody was calculated by measuring the absorbance at 280 mn and setting lmg / ml to 1.350D.

Each of the purified monoclonal antibodies thus obtained will be indicated using the name of the produced hybridoma. For example, an antibody produced by hybridoma 1D6A will be referred to as 1D6A antibody.

[Example 18] Effect of anti-FGF-23 antibody in Atsushi system on PEAK cells expressing klotho protein using EGR1 promoter-luciferase

In order to examine whether the neutralizing activity of the anti-FGF-23 antibody could be measured by the Atsushi system of Example 9, the anti-FGF-23 antibody (2C3B) prepared in Example 15 was examined. The method was performed according to Example 9, and the 2C3B antibody was added to a final concentration of 2.5 Ig / ml immediately before the addition of FGF-23. As a result, the 2C3B antibody significantly suppressed the increase in luciferase caused by FGF-23 (FIG. 11). This indicates that the Atssey system in klotho protein-expressing cells using EGR-1 Promoter-Luciferase is effective in searching for substances that suppress signal transduction of FGF-23 and klotho protein. Was.

[Example 19] Effect of anti-FGF-23 antibody on Atsuyi system in enhancing ERK phosphorylation of CHO ras clone cells by FGF-23 and soluble klotho protein

Neutralization of anti-FGF-23 antibody? To determine whether tongue performance could be measured with the Atsushi system of Example 8, an investigation was conducted using the anti-FGF-23 antibody (2C3B) prepared in Example 15. The method was carried out according to Example 8, and FGF-23 and 2C3B antibodies were added to the cells in a premixed state. As a result, as shown in FIG. 12, the enhancement of ERK phosphorylation by FGF-23 and the soluble k10 tlio protein was suppressed in a 2C3B antibody concentration-dependent manner. This suggests that the assay system for detecting ERK phosphorylation enhancement using FGF-23 and klotho protein is effective in searching for substances that suppress FGF-23 and kl'otho protein signaling. Was done.

[Example 20] Effect of administration of anti-FGF-23 antibody "2C3B antibody" on mice In order to examine the effect of anti-human FGF-23 monoclonal antibody on normal mice, the following experiment was performed. Normal mice (BALBA; male, 12 weeks old) were randomly sorted into 5 groups of 4 animals each, and as shown in Fig. 13, PBS was used as a vehicle in group 1 and 0 in group 1 A single dose of 0.15 ml each of 67 mg / ml anti-human FGF-23 monoclonal antibody (2C3B) and 0.67 mg / ml anti-TP0 monoclonal antibody as a control was injected into the tail vein. . Twenty-four hours after the administration, cardiac blood was collected under ether anesthesia, and serum was separated using Mycrotina (Becton Dickinson, USA). Phosphoric acid concentration in the obtained serum was measured using Phosphorus-Test Co., Ltd. (Wako Pure Chemical Industries, Japan). Serum 1.25 D concentration was measured using a 1,25 (OH) 2D RIA kit TFB (Tifb, USA). Measured according to documentation. Each group was bred in a plastic cage from administration to blood collection, and fed a solid diet containing phosphorus and calcium CE-2 (CLEA Japan) and tap water freely.

The results obtained are shown in FIG. Measured values are expressed as mean + / _ standard deviation in each group. The group marked with * indicates a group that showed a p <0.01 with respect to both the vehicle (PBS) administration group and the anti-TP0 antibody administration group as a result of a significant difference test using student-t. .

[Example 21] Purification of solubilized klo tho protein

The mouse solubilized klo tho protein stably expressing cells prepared in Example 5 were cultured in a roller bottle (Falcon, USA) in SFMI I medium (Invitrogen, USA) for 5 days. After removing the suspended cells from the culture supernatant with a Millistack DE60 filter (Millipore, USA), the supernatant was concentrated approximately 10-fold with a SART0C0N Cassete Hydrosart Cu toff 30000 (Sartorius, Germany). . Concentrated culture supernatant Was adjusted to pH 7.95 with NaOH, and then adsorbed to Q Sepharose ™ FF (Amersham Biosciences, USA). After washing the non-specific adsorbate with a washing buffer (20 mM Tris HCl (pH 8.0) .150 mM NaCl), the elution buffer (20 mM Tris HCl (pH 8.0), 150 mM NaCl to 20 mM Tris HCl (pH 8.0), 500 mM NaCl Eluted). Then Phenyl Sepharose ™ HP (US Amersham Biosciences) after a loading, washed with wash buffer _{_{(700mM (NH 4) 2 S0}} 4), at 700 Rev. (NH _₄₎ ₂ S0 ₄ Dara stringent Elution. Next, using Con A Sepharose ™ 4B (Amersham Biosciences, USA), buffer A (PBS) and buffer B (0.5 MMethyl-alpaD-Glucoside, 0.5 M NaCl, PBS) were eluted stepwise. Elution was performed with Wheat Germ Lectin SepharoseTM 6MB (Amersham Biosciences, USA) using buffer A (PBS) and buffer B (0.5M N-acety to!) -Glucosamine, 0.5M NaCl, PBS in a stepwise manner. Done. Then, using DEAE-Sepharose ™ FF (Amersham Biosciences, USA), elution was performed with a buffer A (20 mM TrisHCl ρΗ80 ·) and a buffer Β (20 mM TrisHCl pH 8.0, 0.5 M NaCl) gradient. Using Q SepharoseTM HP 溶出 Eluted with a gradient of buffer A (10OmM phosphate buffer pH 7.5) and buffer B (10mM phosphate buffer PH7.5, 0.5M NaCl). FIG. 14 shows the results of silver staining of the purified product and the results of Western blotting using the anti-klotho antibody prepared in Example 10.

[Example 22] Production of anti-klotho polyclonal antibody using purified solubilized klotho protein as antigen

22- (1) Preparation of anti-mouse solubilized klotho ゥ sagi polyclonal antibody

The mouse solubilized klotho protein purified by the method described in Example 21 was used for immunization as an antigen. 'Immunization went to two birds. For the first immunization, 50 tig of an antigen per rabbit was emulsified with Freund's complete adjuvant and administered intradermally or subcutaneously to the rabbit. One week after the first immunization, an antigen prepared by emulsifying with Freund's incomplete adjuvant was administered in the same manner. The same administration was performed six more times at two-week intervals, and one week after the final administration, whole blood was collected to prepare antisera.

Antiserum containing anti-mouse-solubilized KL 0 tho antibody was transferred to Protein G Sepharose 4 FF column. (Amersham Pharmacia Biotech, USA) to adsorb the antibody to the column and elute it with 0.1 M glycine buffer (PH2.8). The eluted fraction was adjusted to pH 7.2 by adding 1 M Tris-HCl (pH 9.0). After replacing the antibody solution thus prepared with PBS (-) using a NAP10 column (Amersham Pharmacia Biotech, USA), a 0.22 m pore size membrane filter MILLEX-GV (Millipore, USA) ) To obtain a purified anti-klotho antibody. The concentration of the purified antibody was calculated by measuring absorbance at 280 nm and setting lmg / ml to 1.350D. Since two puppies were immunized, two types of antibodies were obtained. For the purpose of distinguishing between them, these purified antibodies are hereinafter referred to as msKl antibody-1 and msKl antibody-2.

22- (2) Recognition of mouse klotho protein by anti-mouse klotho protein and heron polyclonal antibody

Using the msKl antibody-1 and the msKl antibody-2 obtained by the above method, Western blotting analysis was performed on the mouse solubilized klotho protein prepared in Example 21. As shown in Fig. 15, solubilized mouse klotho protein at around 130 kDa was detected for all antibodies. Therefore, these four types of antibodies were found to be antibodies capable of recognizing mouse solubilized klotho protein and mouse klotho protein having a similar sequence.

[Example 23] Preparation of anti-klotho monoclonal antibody using purified solubilized klotho protein as antigen

23-(1) Production and selection of hybrids

Preparation of the monoclonal antibody in this example was prepared according to a general method as described in Monoclonal Antibody Experiment Procedure Introduction (written by Tamto Ando et al., Published by Kodansha 1991). The animals to be immunized were performed in the following manner using rats.

The mouse solubilized klotho protein prepared in Example 21 was used as an antigen. For the first immunization, the antigen per rat was emulsified with Freund's complete adjuvant and administered intradermally or subcutaneously to the rats. One week after the first immunization, once weekly administration was performed a total of three times, and a 50 S antigen prepared by emulsification with Freund's incomplete adjuvant was similarly administered. Two weeks after the final administration, 50 ig was administered into the tail vein for final immunization. Four days after the final immunization, hybrid I made one.

The spleen was excised from the immunized rat as described above, and the spleen cells recovered from the spleen were mixed with myeloma X-63 Ag 8.6.5.3 (ATCC CRL 1580) and used as a fusion agent in polyethylene glycol solution (Japan). , Immunological Biology Laboratories) to produce hybridomas. The selection of Hypridoma was performed using TIL Med ial containing HAT containing 10% fetal calf serum (Fetal Calf Serum, FCS) and hypoxanthine (H), aminopterin (A), and thymidine (T). (Immune Biological Laboratory, Japan). Cloning was performed by the limiting dilution method to obtain a cloned hybridoma derived from a single cell.

23- (2) Screening of cloned hybridoma producing anti-klotho antibody

By examining the binding property between the antibody produced by the hybridoma and cells expressing mouse klotho, hybridomas producing an antibody that specifically recognizes the klotho protein were selected. 1 × 10 ⁵ cells of the klotho-expressing HEK293 cells described in Example 31 described later were added to each well of a 96-well ELISA microplate (Grainer Inc., USA) and allowed to bind to the plate. Next, the medium was removed, and each well was washed with PBS (-) containing 2% FCS, and then the supernatant of the hybridoma was added, followed by incubation at 4 ° C for 30 minutes, followed by washing. Peroxidase-labeled anti-rat IgG goat IgG Fab '(Southern Biotech, USA) diluted 2000-fold was added and incubated at 4 ° C for 30 minutes. After washing, a substrate buffer containing tetramethylbenzidine (DAK0, Denmark) was added to each well and incubated at room temperature for 8 minutes. Then, 1 M sulfuric acid was added to each well to stop the reaction. The absorbance at a wavelength of 450 nm was measured with a microplate reader (Emax, Molecular Devices, USA). Here, hybridomas showing a clear increase in absorbance were selected, and six clones (3GK 4A1, 9A1, 12BK 67G4 and 70E2) were obtained as hybridomas producing antibodies recognizing the klotho protein. The subclass of the antibody specifically recognizing the klotho protein thus obtained was identified using Rat MonoAB ID / SP KIT (ZYMED LABORATORIES, USA). The results are shown in Table 2. Table 2

67G4 IgG1 (κ)

70E2 IgG1 (κ) Of the above hybridoma clones, three hybridoma clones 4Α1, 9Α1, and 12B1 were purchased by the National Institute of Advanced Industrial Science and Technology, National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary on March 30, 2004. An international deposit was made at Chome No. 1 1 Central No. 6) based on the Budapest Treaty. The accession numbers are as follows. ski A1: FERM BP- 08678

ski 9A1: FERM BP- 08679

ski 12A1: FERM BP- 08680

23- (3) Preparation of culture supernatant containing anti-klotho monoclonal antibody

Anti-klotho antibody-producing hybridoma was prepared by adding 10 g / ml of cincinulin (Sigma, USA), 5.51 g / ml of human transferrin (Sigma, USA), 0. OlmM ethanolamine (Sigma, USA), 5 ng / ml ERDF medium (Farto Seiyaku, Japan) containing 1% sodium selenite (Sigma, USA) and 1% low IgGFCS (Hyclone, USA). The hybridoma is cultured to prepare the antibody, and the culture solution is passed through a filter with a pore size of 0 (Pall Gelman Laboratory, USA) to remove foreign substances such as the hybridoma, and the culture containing the antibody is removed. Qing was recovered.

23- (4) Purification of Monoclonal Monoclonal Antibody Using Protein G

The culture supernatant containing the anti-klotho antibody was applied to a protein G Sepharose4FF column (US,

Amersham Pharmacia Biotech), the antibody was adsorbed on the column, and eluted with 0.1 M glycine buffer (PH2.8). The eluted fraction is added with 1 M Tris-HC1

Adjusted to PH7.2. The antibody solution thus prepared is applied to a gel filtration column NAP25 (US,

Replace with PBS (-) using Amersham Pharmacia Biotech, and use a 0.22

'I Filtrated and sterilized with Millex-GV (Millipore, USA) and purified anti-FGF-23 Antibodies were obtained. The concentration of the purified antibody was calculated by measuring absorbance at 280 ηπι and setting 1 mg / ml to 1.350 D.

Each of the purified monoclonal antibodies thus obtained will be indicated using the name of the produced hybridoma. For example, an antibody produced by hybridoma 4A1 will be referred to as a 4A1 antibody.

23- (5) Confirmation of binding of anti-mouse solubilized klotho rat monoclonal antibody to mouse klotho

The following experiments showed that the anti-mouse solubilized klotho rat monoclonal antibody binds to the mouse solubilized klotho. Immunoprecipitation was performed using a culture supernatant containing mouse-solubilized klotho protein obtained in the same manner as in Example 8. Six kinds of anti-klotho mouse monoclonal antibodies (3G1 antibody, 4A1 antibody) prepared and purified by the method described in Examples 23- (1) to 23- (4) in 200 L of culture supernatant containing mouse-solubilized klotho protein Antibody, 9A1 antibody, 12B1 antibody, 67G4 antibody, 70E2 antibody) and rat IgG1 and rat IgG2b antibodies that do not recognize klotho as controls, and mix by inverting at 4 ° C for 1.5 hours. Each complex was formed. These complexes contain protein GSepharose

Add 15 L of 4FF column (Amersham Pharmacia Biotech, USA) at 4 ° C

After mixing by inversion for 2 hours, the mixture was centrifuged and separated into a liquid phase (non-resin-adsorbed material) and a resin containing immunoprecipitates. The resin was thoroughly washed with PBS (-) to remove non-specifically bound substances. Add 50 1 sample buffer (50 mM Tris-CI pH 6.8, 0.4% SDS,

After addition of 6% glycerol, 0.002% bromphenol blue, 2%) 3 mercaptoethanol) and heating at 95 ° C for 5 minutes, the supernatant (resin adsorbate) obtained by centrifugation was collected. The resin adsorbate was analyzed by the western blotting method using the mklotho-118 antibody obtained in Example 10. Figure 16 shows the results. Analysis of the resin adsorbate by Western blot analysis using anti-klotho antibody showed that soluble klotho was adsorbed to the resin in the sample to which 3G1, 4A1, 9A1, 12B1, 67G4, and 70E2 antibodies were added. In other words, that is, immunoprecipitation was observed. From these results, it was confirmed that the anti-klotho rat monoclonal antibody described above binds to mouse solubilized klotho. Example 24 Measurement of Neutralizing Activity of Anti-klotho Polyclonal Antibody Using Purified Solubilized klotho Protein as Antigen in EGR 1 Promoter Lucifera Zeatosis System Anti-klotho Polyclonal Prepared in Example 22 The inhibitory effect of the antibody on the FGF23 stimulation in the EGR1 promoter-Lucifera azetus system was examined.

The method was performed according to Example 9, and an anti-klotho polyclonal antibody was added to the cell culture solution before stimulation with FGF23. FGF23 stimulation was performed at a final concentration of 10 ng / ml. As a result, as shown in FIG. 17, all of the anti-klotho polyclonal antibodies suppressed the stimulation by FGF23 in a concentration-dependent manner. This indicated that the anti-klotho antibody prepared in Example 22 suppressed FGF23-induced stimulation of cells.

[Example 25] Effect of administration of anti-clotho polyclonal antibody to mice using purified solubilized kliotho protein as an antigen

The effect of administering the anti-klotho polyclonal antibody prepared in Example 22 to mice was examined. BALB / c, male, Ί week-old normal mouse Anti-mouse klotho protein obtained in Example 22 ゥ Heron polyclonal antibody mskl antibody-1, 2 A single dose of 0.2 mL was administered. To the control group, 0.2 mL of the persimmon serum before klotho immunization purified under the same conditions as in Example 22 was injected into the tail vein in an amount of 0.2 mL. 9 hours after administration, blood was collected from the orbit using a glass capillary, serum was separated using Microtina (Becton Dickson, USA), and blood was collected 24 hours later from the heart, and serum was also collected using Microtina. Was separated. Nine hours after the obtained serum, the concentration of 1,25-dihydroxyvitamin D was measured using a 1,25 (OH) 2D RIA kit “TFB” (Tiefbee, Japan). The phosphate concentration of the serum 24 hours later was determined using Phospha C-Test Co., Ltd. (Wako Pure Chemical Industries, Japan) according to the package insert. The group treated with anti-klotho polyclonal antibody and the control group each consisted of 5 mice, and had a solid diet containing tap water and 1.03% inorganic phosphate and 1.18% calcium CE2 (Japan, (Clear Japan, Inc.)

As shown in Fig. 18, a single dose of anti-mouse clone protein ゥ sagi polyclonal antibody significantly increased serum dihydroxyvitamin D in both mskl antibodies _ 1 and 2 after 9 hours compared to the control antibody-administered group. (Tt es t ** p <0.01) and 24 There was a significant increase in serum phosphate after time (t tes t * 0.05).

(Example 26) Measurement of neutralizing activity of anti-klotho monoclonal antibody using purified purified solubilized klotho protein as antigen as an antigen in EGR 1 promoter / luciferase Atsushi system Example 2 of anti-klotho monoclonal antibody prepared in Example 23 The inhibitory effect of the EGR1 promoter-luciferase atsey system on FGF23 stimulation was examined. The method was the same as in Example 24. FGF23 stimulation was performed at a final concentration of 10 ng / ml. Anti-klotho monoclonal antibodies were skl4Al, skl9Al, and ski12B1 antibodies, and IgGl and IgG2b subtype control antibodies were used as controls. The concentration was shaken in tenths from lOO ^ g / ml to 0.1 g / ml. As a result, as shown in FIG. 19, the skl9Al anti-klotho monoclonal antibody suppressed the stimulation by FGF23 in a dose-dependent manner. No inhibition was confirmed with the skl4Al antibody or the skl12Bl antibody. This indicated that the anti-klotho antibody skl'9Al prepared in Example 23 suppressed the stimulation of cells by FGF23.

[Example 27] Effect of mouse administration of anti-klotho monoclonal antibody using purified solubilized klotho protein as antigen

BALB / c, male, 6-week-old normal mouse, 6 kinds of anti-mouse-solubilized klotho rat monoclonal antibodies obtained in Example 27 (3G1, 4A1, 9A1, 12B1, 67G4, and 70E2 antibodies) Each animal was administered once from the tail vein at a dose of 100 g / 0.2 mL per animal. To the control group, a rat IgG1 antibody that did not recognize klotho was administered as a control antibody by 0.2 mL in a tail vein. Nine hours after administration, blood was collected from the orbit using a glass capillary, serum was separated using Microtina (Becton Dickson, USA), and 24 hours later, blood was collected from the heart, and serum was also used using Microtina. Was isolated. Nine hours after the obtained serum, the concentration of 1,25-dihydroxyvitamin D was measured using a 1,25 (OH) 2D RIA kit “TFB” (TFB, Japan). Phosphoric acid concentration in serum 24 hours later was determined using Phospha C-Test II Co. (Wako Pure Chemical Industries, Japan) according to the package insert. Anti-mouse-solubilized klotho rat Monoclonal antibody-administered group and control group each consisted of 5 mice, each consisting of tap water and a solid diet containing 1.03% inorganic phosphate and 1.18% calcium CE2 (Clea Japan, Japan). As shown in Fig. 20, after a single dose of the anti-mouse solubilized klotho rat monoclonal antibody, 9 hours after treatment with 4 types of 3G1, 9A1, 67G4, and 70E2 antibodies compared to the control antibody-administered group Significantly increased in serum dihydroxyvitamin D (t test * 0.05, 0.01) and serum phosphate 24 hours later (t test * 0.05, ** p <0.01) .

[Example 28] Effect of simultaneous addition of purified solubilized klotho protein and purified FGF23 to human and mouse cultured cells to stimulate cells

In order to confirm the activity of the purified solubilized klotho obtained in Example 21, the effect of stimulating cells with the solubilized klotho and FGF23 was examined using HEK293 cells in the same manner as in Example 8. The solubilized klotho used for the stimulation was stimulated at a concentration of 4 g / m FGF23 at a concentration of 100 ng / ml. As a result, as shown in FIG. 21, only when stimulation with solubilized klotho and FGF23 was performed, the phosphorylation of ERK in cells was enhanced.

In addition, mouse osteoblast-derived cells were solubilized in MC3T3-E1 cells. Klotho was stimulated at a concentration of 4 g./mK FGF23 at a concentration of 100 ng / ml, and cultured for 48 hours. As a result, as shown in FIG. 22, the cell morphology of the cells stimulated with solubilized klotho and FGF23 changed to fibroblast-like cells as in the case of bFGF stimulation.

These results indicate that cells were stimulated only when co-stimulation with solubilized klotho and FGF23 was performed.

[Example 29] Effect of purified solubilized klotho protein on mouse administration

BALB / c, male, 7-week-old normal mice were administered a single dose of the mouse-solubilized klotho protein obtained in Example 21 via the tail vein at 10 g / 0.2 mL. To the control group, 0.2 mL of PBS was administered into the tail vein in a dose of 0.2 mL. Nine hours after the administration, blood was collected from the orbit using a glass capillary, and the serum was separated using Microtina (Becton Dickson, USA). Nine hours after the obtained serum, the 1,25-dihydroxyvitamin D

The measurement was performed using a 1,25 (0H) 2D RIA kit "TFB" (Tifby, Japan). Mouse-solubilized klotho protein-treated and control groups consisted of 5 mice each, and consisted of a solid diet containing tap water and 1.03% inorganic phosphate and 1.18% calcium CE2 (CLEA Japan, Japan) ).

As shown in Figure 23, a single dose of mouse solubilized klotho protein A significant increase in serum dihydroxyvitamin D was observed 9 hours later compared to the control group (t tes t * 0 · 05)

[Example 30] Preparation of anti-FGF23 polyclonal antibody

To obtain a polyclonal antibody against human FGF23, an anti-FGF23 full-length polyclonal antibody was obtained in the same manner as in Example 22 using the purified human FGF23 obtained in Example 15.

[Example 31] Binding of FGF23 to klotho-expressing cells

The binding between klotho expressed in the cells and FGF23 was confirmed by the following method.

31- (1) Preparation of klotho stably expressing HEK293 cells

To obtain mouse klotho full-length stable expression HEK293 cells, mouse klotho full-length stable expression HEK293 cells were obtained in the same manner as in Example 5, using the mklot o / IRES-EGFP-pEAK8 vector obtained in Example 3.

31- (2) Confirmation of binding between klotho and FGF23

Using the mouse klotho full-length stable expression HEK293 cells prepared in 31- (1), FGF23 bound to the cells was detected. Example 3 Klotho Stable Expression Obtained in 1— (1)

HEK293 cells were detached from the culture vessel using a cell detachment buffer (0.52 mM EDTA, PBS), and suspended in a suspension buffer (2% calf serum, lmM EDTA, 0.05 NaN ₃ ). The human FGF23 obtained in Example 15 was added at a concentration of l ^ g / ml and left on ice for 30 minutes. After washing with a suspension buffer, the anti-FGF23 polyclonal antibody obtained in Example 30 was added at a concentration of 20/2 g / ml, and the mixture was allowed to stand on ice for 30 minutes. After washing with a suspension buffer, an anti-Egret IgG PE-modified antibody (Southern Biotechnology Asso-Shats, USA) was added, and the mixture was allowed to stand on ice for 30 minutes. After washing with the washing buffer, the fluorescence intensity of the cells was detected using a FACS Cal iber device (Becton Dickinson, USA). The results are shown in FIGS. 24A and B. In Fig. 24 4A and B, the four graphs from the top show the fluorescence intensity when using anti-FGF23 antibody, FGF23 + anti-FGF23 antibody, FGF23 + control antibody and FGF23, respectively, and the bottom graph Is a graph that combines the top four graphs. Klotho full-length stable expression

Only when FGF23 was added, the fluorescence intensity was strong, and such a result was not obtained in HEK293 cells. This indicates that klotho expressed in cells and FGF23 bind. Was shown. All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety. Industrial potential

As shown in the Examples, administration of klotho protein reduces or increases the blood 1,5 dihydroxyvitamin D concentration and serum phosphorus concentration. In addition, administration of anti-kolotho protein antibody increases blood 1,25-dihydroxyvitamin D concentration and serum phosphorus concentration. The administration of klotho protein enhances or inhibits the action of FGF23 in the body, and the administration of the antibody klotho protein antibody inhibits the action of FGF23 in the body. These examples demonstrate that klotho protein and anti-kolotho protein antibodies alter blood 1,25-dihydroxyvitamin D and serum phosphorus levels, and are used in the treatment of diseases involving phosphorus and / or vitamin D and / or FGF23. Z or indicates that it can be used for prevention.

Sequence Listing Free Text

SEQ ID NOs: 4 to 22, 28 to 30 and 32 to 35: Synthesis 0

SEQ ID NOS: 24 to 27, 31: Synthetic peptide

Claims

The scope of the claims

1. A pharmaceutical composition for lowering blood phosphorus concentration and blood or active vitamin D concentration, comprising klotho protein as an active ingredient.

2. A pharmaceutical composition containing klotho protein as an active ingredient for increasing blood phosphorus concentration and blood or active vitamin D concentration.

3. A pharmaceutical composition for enhancing the action of FGF23, comprising a klotho protein as an active ingredient.

4. A pharmaceutical composition for inhibiting the action of FGF23, comprising a klotho protein as an active ingredient.

5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the klotho protein is a solubilized klotho protein.

6. A pharmaceutical composition containing an anti-klotho protein antibody as an active ingredient for increasing blood phosphorus level or blood active vitamin D level.

7. A pharmaceutical composition for inhibiting the action of FGF23, which comprises an anti-klotho protein antibody as an active ingredient.

8. Neoplastic osteomalacia, ADHIL XLH, renal osteodystrophy, dialysis osteopathy, osteoporosis, hypophosphatemia, cull disease, osteomalacia, tubular dysfunction, osteopenia, hypocalcemia, Hyperphosphatemia, hyper-1.25D, hyperparathyroidism, ectopic calcification, pruritus, bone sclerosis, Paget's disease, hypercalcemia, hypoparathyroidism, bone pain, muscle weakness, The method according to any one of claims 1 to 7, which is used for treating and / or preventing a disease involving phosphorus and / or vitamin D selected from the group consisting of skeletal deformity, growth disorder, and hypo1,25Demia. Pharmaceutical composition.

9. A method for screening for substances that alter blood phosphorus concentration and / or blood active vitamin D concentration, by contacting FGF23 with klotho protein, and intracellular signals due to the interaction between FGF23 and klotho protein. A screening method by detecting '